Method for obtaining molecular marker related to malformation trait of gynogenesis hypophthalmichthys nobilis and application of molecular marker
A technology related to molecular markers and gynogenesis, applied in the fields of aquatic animal genetics and molecular marker-assisted selection breeding, can solve the problems of no SNP molecular markers reported, and achieve accurate and reliable identification results, simple operation, and the effect of solving blindness.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The SNP markers of the present invention are derived from the simplified genome data constructed by the gynogenetic bighead carp 2b-rad method in our laboratory, and the loci significantly related to the deformity traits of bighead carp obtained through analysis.
[0039] (1) The gynogenetic bighead carp used in the experiment was collected from the Zhangdu Lake fishery in Xinzhou District, Wuhan. The bighead carp used was one month old. Six normal bighead carp and six deformed bighead carp were selected. Genomic DNA was extracted from the caudal fin of The 2b-rad method for library construction is mainly divided into enzyme digestion, ligation, amplification and recovery.
[0040] Digestion:
[0041] 2b-RAD bank building was carried out on 6 deformed and 6 normal bighead carps with known deformities and normal body sizes bred in this laboratory. The specific process is as follows (the following is the amount used for each individual):
[0042]
[0043] After mixing...
Embodiment 2
[0063] Design and verification of primers based on long sequences related to deformity traits of gynogenetic bighead carp
[0064] (1) Design a pair of primers according to SEQ ID NO:2, the sequence of which is:
[0065] Forward primer F: TGTTGTCAATGCCCAATACC, as shown in SEQ ID NO:3;
[0066] Reverse primer R: CACAATGTGCCTACGCTGTT, as shown in SEQ ID NO:4;
[0067] (2) Select 65 gynogenetic bighead carps from the same batch of 6-month-old gynogenetic bighead carp cultured in our laboratory, including 34 deformed individuals and 31 normal individuals, and perform PCR verification on their genomic DNA samples. The PCR reaction procedure is as follows :
[0068] PCR loading information
[0069]
[0070]
[0071] PCR program settings
[0072]
[0073] (3) The amplified product is detected by electrophoresis on agarose, and the results are as follows: figure 1 As shown, a 475bp band can be amplified, the amplified product is sequenced by Sanger method, the sequencin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


