Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain
A technology of gene expression and tilapia, applied in chemical instruments and methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of easy broken egg shells and low success rate, and achieve egg damage and success The effect of high rate and strong application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] The acquisition of a set of antisense RNAs for promoting gonadal degeneration of tilapia males comprises the following steps:
[0068] Step 1: Design of the first antisense RNA sequence (Anti-AMH-1):
[0069] TTTTTCCATTCAAAGTTAACGAGTTATTAATTAATCAGCTGAGCGGCGTCTGACCGGTTACTGTGGGGTCCTGGGCCGGTTGCAGGGTCCAGCAGAGTGTCAGCGCC (SEQ ID No. 1).
[0070] The antisense RNA includes the first intron partial sequence and the first exon partial sequence, and its design purpose is to interfere with the post-transcriptional processing of the AMH gene.
[0071] Step 2: The second antisense RNA sequence design (Anti-AMH-2):
[0072] GTGTCAGCGCCTCGCTGTAAAGAACGAGCAGACCCAACATGTTTGCAGTGTCTGCGTGTGCGTTTGTGTGGTCAGATCTCTCACAGGATGGGAGTTACATCCT (SEQ ID No. 2).
[0073]The antisense RNA contains part of the 5-terminal untranslated sequence and the first exon partial sequence, including the initiation codon, and its design purpose is to interfere with the translation of the AMH gene.
Embodiment 2
[0075] The two antisense RNAs designed in Example 1 were entrusted to Suzhou Jinweizhi Biotechnology Co., Ltd. for artificial synthesis to obtain antisense RNA1 and antisense RNA2.
[0076] PCR amplification: the antisense RNA1 and antisense RNA2 are respectively cloned into the pcDNA3.1 expression vector (containing the highly expressed CMV promoter), and this product is used as a template for subsequent PCR amplification. A pair of specific primers were designed for template amplification (PolyAF2:TTTTGCGCTGCTTCGCGATGTAC, SEQ ID NO.3; reverse primer polyAR1:TCCCCAATCCTCCCCCTTGCTG, SEQ ID NO.4). The reaction system is 50 μl, including 25 μl of 2×Mastermix, 5 μl of primers, 18 μl of ultrapure water, and 2 μl of template. The amplification program was: pre-denaturation at 95°C for 2 min, 34 cycles (denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 2 min); extension at 72°C for 5 min. This PCR product contains the CMV enhancer to the tailing seque...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com