Check patentability & draft patents in minutes with Patsnap Eureka AI!

Separation and culture method for Lawsonia intracellularis

A culture method and technology of Lawsonia, applied in the field of isolation and culture of Lawsonia intracellulare, to achieve the effect of increasing the success rate, avoiding pollution and increasing the quantity

Pending Publication Date: 2020-11-20
NANJING AGRICULTURAL UNIVERSITY
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the special culture conditions, only a few laboratories in the world have the ability to isolate the bacteria, and there is no report on the successful isolation and culture of LI in China. The method of isolating and culturing LI, which is of great significance to the prevention and control of PPE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Separation and culture method for Lawsonia intracellularis
  • Separation and culture method for Lawsonia intracellularis
  • Separation and culture method for Lawsonia intracellularis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] The preparation of embodiment 1 Lawsonia intracellulare isolate

[0061] Take out the suspected porcine ileum sample with typical symptoms of PPE from the -80°C refrigerator, quickly melt it and wash it three times with PBS, cut the intestinal tube longitudinally, scrape the intestinal mucus into a 50mL centrifuge tube with a sterile glass slide, and add pancreatic Enzyme, digest at 37°C for 30 minutes, add 30 mL of SPG solution containing 10% FBS to the digested intestinal mucus, place the diluted intestinal mucus in a tissue homogenization tube for homogenization, and filter the homogenate with a 200-mesh cell sieve , the filtrate was collected in a 50mL centrifuge tube, and then passed through 1.2, 0.8 and 0.65μm filter membranes successively, and finally DMSO was added to the filtrate with a final concentration of 10% to obtain Lawsonia intracellulare isolates, and each tube of 1mL was divided into 1.5mL Store in EP tubes at -80°C.

Embodiment 2

[0062] Example 2: Isolation and cultivation of Lawsonia intracellulare

[0063] 1) Recovery and subculture of McCoy cells

[0064] The McCoy cells were taken out from the liquid nitrogen, and quickly put into a 37°C water bath to melt, and the melted cells (cell density about 5×10 6 per mL) into 8 mL of HDMEM culture medium containing 10% FBS, 37°C, 5% CO 2 Cultivate under conditions, after the cells grow to a single layer, wash with sterile PBS 3 times, digest with 0.25% trypsin, stop the digestion when a small amount of cells fall off, discard the digestion solution, add DMEM cell culture medium containing 10% FBS, Repeated blowing several times to disperse into a single cell, draw an appropriate amount of cell fluid to another cell bottle for subculture, and use it after the cells adapt to the culture environment.

[0065] 2) Bacterial inoculation and culture

[0066] Will 1×10 5 When each / mL McCoy cells were cultured to a confluence of about 30%, the culture solution w...

Embodiment 3

[0069] Example 3: Identification of Lawsonia intracellulare

[0070] 3.1 Transmission electron microscope observation of the morphology of Lawsonia intracellulare strains in McCoy cells

[0071] Prepare ultrathin slices of the samples obtained in Example 2 after inoculating McCoy cells with Lawsonia intracellulare for 3 hours. After staining with phosphotungstic acid, observe under a transmission electron microscope whether the McCoy cytoplasm contains bacteria consistent with the morphological characteristics of LI; The results are shown in Figure 1. Rod-shaped and comma-shaped bacteria can be observed in the cytoplasm of McCoy cells, which is consistent with the morphological characteristics of Lawsonia intracellulare.

[0072] 3.2 Ordinary PCR identification

[0073] In this experiment, the LI aspA gene (F: GCTGTGGATTGGGAGAAATC; R: CAAGTTGACCAGCCTCTGC) was synthesized according to literature reports, and the amplified sequence was 167bp. Use the bacterial genomic DNA extr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a separation and culture method for Lawsonia intracellularis. The method comprises the following steps: preparation of Lawsonia intracellularis isolation; subculture of McCoy cells; bacterium inoculation and culture; generation transferring and cryopreservation of Lawsonia intracellularis; and identification on the Lawsonia intracellularis. According to the method, the McCoy cells are used as host cells and are applied to the separation and culture of the Lawsonia intracellularis, the vacancy that the Lawsonia intracellularis is not successfully separated and cultured from a body of a pig yet domestically is filled up, and a foundation is settled for research and development of attenuated vaccines of the Lawsonia intracellularis and research on a pathogenesis mechanism.

Description

technical field [0001] The invention belongs to the technical field of veterinary biological products, and in particular relates to a method for isolating and cultivating Lawsonia intracellulare. Background technique [0002] Lawsonia intracellularis (LI) is a common enteropathogenic bacterium in the pig industry, and it is the pathogen of porcine proliferative enteropathy (PPE). LI mainly causes slow growth and development of growing and finishing pigs, and It is ubiquitous in pig farms all over the world and has become an important enteric disease in modern pig farming. According to reports, the annual losses caused by PPE in the United States and the United Kingdom are as high as 20 million US dollars and 4 million pounds respectively. In Europe, the disease causes an economic loss of more than 1 Euro per fattening pig per year. In addition, the disease is prevalent worldwide, and the infection rate is very high. More than 20 countries including Canada, Finland, Brazil,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N1/02A61K39/02A61P31/04C12R1/01
CPCC12N1/02A61K39/0208A61P31/04A61K2039/552C12R2001/01C12N1/205
Inventor 范红结肖宁周红李剑男李敏雪蔺辉星
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More