Tumor immunotherapy composition based on specific immune cells, preparation method and application

A technology of immune cells and cells, applied in the direction of blood/immune system cells, biochemical equipment and methods, tumor-specific antigens, etc., can solve the problems of limited affinity of tumor antigens, insufficient targeting and safety, and achieve targeted Improved performance and safety, simple and convenient operation, and strong controllable conditions

Pending Publication Date: 2020-11-27
SUZHOU ROYALTECH MED CO LTD +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0022] In view of the problems existing in the existing technology, for example: the adoptive immunotherapy of cells has the defects of limited affinity of T cells to tumor antigens, insufficient targeting and safety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor immunotherapy composition based on specific immune cells, preparation method and application
  • Tumor immunotherapy composition based on specific immune cells, preparation method and application
  • Tumor immunotherapy composition based on specific immune cells, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0135] Embodiment 1: Construction of the plasmid of attenuated listeria

[0136] Attenuated Listeria is used in the present disclosure as a carrier strain for vaccine preparation. Exemplary, what the present disclosure is used as the bacterial strain of vaccine adopts Lm 10403SΔactA (the construction method of aforementioned bacterial strain can exemplarily refer to the following literature: Shen H et.al., PNAS, 92 (9): 3987-91, 1995 ), the bacterium lacks the actA gene, so that the bacterium infecting the host cell cannot spread to adjacent cells through its unique actin tail, thereby greatly reducing its toxicity and pathogenicity. Compared with the wild-type strain Lm 10403S (LD 50 1x 10 4 ), the LD50 of Lm-ΔactA is 0.5x10 8 -1x10 8 , proved to be highly attenuated. At the same time, the bacterium retains the ability of complete LLO to escape from lysosomes, enters the cytoplasm of host cells and proliferates rapidly, and expresses proteins to activate specific T cel...

Embodiment 2

[0146] Embodiment 2: Construction of the plasmid of the attenuated Listeria carrying antigenic peptide gene

[0147] The construction of the attenuated Listeria vaccine plasmid requires the insertion of the antigen gene into the plasmid vector, which has been designed with restriction sites, and the gene sequence of the target antigen is synthesized after optimization of the gene codon by the company.

[0148] Optional, OVA 28 The codon optimization process is as follows:

[0149] Mouse OVA before corresponding codon optimization 28 Nucleotide sequence (SEQ ID NO:5):

[0150] GATGAAGTCTCAGGCCTTGAGCAGCTTGAGAGTATAATCAACTTTGAAAAACTGACTGAATGGACCAGTTCTAATGTTATGGAA

[0151] Codon-optimized OVA with Escherichia coli codons as preferred codons 28 Nucleotide sequence (SEQ ID NO:6):

[0152] GATGAAGTGAGCGGCCTGGAGCAGCTGGAGAGCATTATCAACTTCGAAAAACTGACCGAGTGGACCAGCAGCAATGTGATGGAA

[0153]The product is cloned into the PstI site on the pAM401-Phly-LLO1-28-BamHI-LLO22-523-PstI-LLO524-5...

Embodiment 3

[0166] Example 3: Preparation of attenuated Listeria carrying a non-integrating antigenic peptide plasmid

[0167] Sequencing verified that the correct attenuated Listeria plasmid was transformed into an attenuated Listeria strain by electroporation technology, and a single clone was selected for subsequent plasmid and expression verification.

[0168] Specific steps of electroconversion:

[0169] (1) Preparation of electroporation competent state

[0170] a) The overnight cultured Listeria was transferred to 100-250ml brain-heart infusion broth medium (BHI) at a ratio of 1:50-1:200, and cultured with shaking at 37°C until OD 600 Value 0.2-0.25;

[0171] b) Add penicillin (PNG) to a final concentration of 10 μg / ml, and continue culturing for about two hours until the OD600 reaches 0.3-0.9;

[0172] c) After 10 minutes of ice bathing, the bacteria were collected by centrifugation at 5000g;

[0173] d) resuspend the bacterium with 200ml 10% glycerol, wash twice;

[0174] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The disclosure relates to a tumor immunotherapy composition based on specific immune cells, particularly non-integrated-antigen-peptide-plasmid-carrying attenuated-Listerella-activated specific immunecells, a preparation method and application. According to the disclosure, T cells are extracted in vitro, attenuated-Listerella-activated antigen presenting cells and the T cells are co-cultured, T cells with specific tumor antigen peptides are generated in vitro, and the specific T cells are fed back in vivo to generate tumor-specific immune reactions. According to the technical scheme disclosedby the disclosure, tumor-specific T cells can be specifically activated, and thus, a series of antitumor immune reactions are initiated; and an operating process has no need of carrying out gene reforming on autologous cells, and both targeting performance and safety are improved remarkably.

Description

technical field [0001] The present disclosure mainly relates to the field of biotechnology, and specifically, the present disclosure relates to a tumor immunotherapy composition, preparation method and application. More specifically, the present disclosure relates to a tumor immunotherapy composition, preparation method and application based on specific immune cells activated by attenuated Listeria carrying a non-integrated antigen peptide plasmid. Background technique [0002] With the in-depth research and understanding of the occurrence and development of tumors, the body's anti-tumor immune response, tumor immune escape, and tumor microenvironment, tumor biotherapy based on immunotherapy, as an emerging modern tumor treatment model, can effectively make up for the It overcomes some defects of traditional treatment methods and provides new ideas and directions for tumor treatment. At present, the main research directions of tumor immunotherapy include tumor vaccines, che...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N1/21C12N15/62A61K39/00A61K45/06A61P35/00A61P35/04
CPCA61K39/0011A61K45/06A61K2039/5154A61K2039/5158A61P35/00A61P35/04C07K14/195C07K14/4748C07K14/77C07K2319/00C12N5/0636C12N5/0639C12N5/0645C12N2502/1121C12N2502/1157C12N2510/00
Inventor代楠张可赵勇刚
OwnerSUZHOU ROYALTECH MED CO LTD