Construction method of Cyp1a1 gene knockout mouse model and application of Cyp1a1 gene knockout mouse model in sepsis
A gene knockout mouse and construction method technology, applied in the field of biomedicine, can solve problems such as ambiguity, and achieve the effects of improved viability, high knockout efficiency, and enhanced bacterial removal ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Construction and Identification of Cyp1a1-KO Mouse Model
[0029] 1. Experimental animals
[0030] The mouse strain used in this example is: C57BL / 6J, and the surrogate mother mouse strain is C57BL / 6J.
[0031] 2. Experimental method
[0032] 2.1 Knockout mouse construction method
[0033] 2.1.1 Construction of sgRNA plasmid expressing mouse Cyp1a1 gene exon2-7
[0034] The gene sequence of Cyp1a1 gene exon2-7 and the designed sgRNA information are as follows:
[0035] Exon2-7 sequence:
[0036]
[0037]
[0038]
[0039]
[0040] The underlined part in the above gene sequence (SEQ ID No: 1) represents the exon region, and the ununderlined part represents the intron region.
[0041] The sgRNA sequence is as follows:
[0042] Cyp1a1-Sg1: CACCTCTCTTAATTGTG (SEQ ID No: 2)
[0043] Cyp1a1-Sg2: CTCTAGAAGTGGGCTACTT (SEQ ID No: 3)
[0044] Cyp1a1-Sg3: TCATTCCTTTACTCTAGACC (SEQ ID No: 4)
[0045] Cyp1a1-Sg4: GCTGTTTAGCCTCAGC (SEQ ID No: 5)
[0046]...
Embodiment 2
[0071] Example 2 Application of Cyp1a1-KO mouse model
[0072] In order to better demonstrate the application of the Cyp1a1-KO mouse model of the present invention, the experimental methods given below are all better or optimal implementations of mouse model establishment.
[0073] 1. Analysis of bacterial clearance ability of Cyp1a1 knockout mice
[0074] 1.1 Experimental method
[0075] The ability of Cyp1a1 knockout mice to clear Escherichia coli was analyzed by counting bacteria in peripheral blood.
[0076] 1.1.1 Activate Escherichia coli in sufficient quantity overnight, wash twice with saline and resuspend, then calculate the concentration of Escherichia coli by colorimetry.
[0077] 1.1.2 Random number table method to select 12 6-8 weeks old, similar weight, male Cyp1a1 + / + and Cyp1a1 - / - mice, each mouse was injected 5x 10 via the tail vein 7 CFU E. coli.
[0078] 1.1.3 After 6 hours, the mice were sacrificed, the peripheral blood was taken, diluted 100 times, e...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com