Application of KMT2D in preparation of antitumor drugs

An anti-tumor drug, KMT2D-LCD1 technology, is applied in the application field of KMT2D in the preparation of anti-tumor drugs, and can solve the problems of unreported functions and unclear tumor functions.

Pending Publication Date: 2020-12-11
NANTONG UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the function of KMT2D protein liquid-liquid phase separation on tumor function is unclear
For the KMT2D protein, bioinformatics analysis contains two highly disordered regions, namely KMT2D-LCD1 and KMT2D-LCD2, and the functions of these two regions have not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of KMT2D in preparation of antitumor drugs
  • Application of KMT2D in preparation of antitumor drugs
  • Application of KMT2D in preparation of antitumor drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] 1. Structural analysis of KMT2D protein and determination of LCD domain

[0044]Referring to the relevant information in the NCBI database, the amino acid sequence of Histone-lysine N-methyltransferase 2D (KMT2D) (GenBank: NP_003473.3) was obtained, and the KMT2D protein structure mainly included two clusters of PHDFinger regions (3) and one at the N-terminus PHD Finger, N-terminal contains FYRN and FYRC domains, and also contains a core methyltransferase structure SET region, its structure is as follows figure 1 As shown, the full-length KMT2D protein contains 5537 amino acids, constituting the core structure of the KMT2D methylation enzymatic complex.

[0045] The disordered structure of the KMT2D protein was analyzed by the Predictor of Natural Disordered Regions software, and it was found that there were two highly disordered regions in the KMT2D protein, such as figure 2 Shown, namely LCD1 and LCD2. Further analysis found that the LCD1 structure is located at 31...

Embodiment 2

[0049] 1. The knockout strategy of LCD1 domain and its verification

[0050] Aiming at the first disordered protein structure in KMT2D protein, that is, LCD1, which is located in the 8th exon to the 11th exon in its corresponding gene, two sgRNAs (sgRNA A1 and sgRNA A2), and two sgRNAs (sgRNA B1 and sgRNA B2) are designed downstream. The sgRNA sequence is as follows:

[0051] sgRNA A1: ccggggacaatagggcagaatca (SEQ ID NO. 1)

[0052] sgRNA A2: ccgggagtgggcaaaacaggcat (SEQ ID NO. 2)

[0053] sgRNA B1: ccggtgaggggctatctagctgc (SEQ ID NO. 3)

[0054] sgRNA B2: ccgcaggactgtacctctgacag (SEQ ID NO. 4).

[0055] Such as Figure 4 As shown, the LCD1 region was knocked out in 293T and PANC1 cells using CRSPR Cas9 gene editing technology.

[0056] 1.1 Synthesis of sgRNA

[0057] The sequence of the designed sgRNA primer was synthesized (Suzhou Jinweizhi Biotechnology Co., Ltd.), and the vector epiCRISPR was cut through the specific enzyme cutting site BspQI. Then use T4 ligase to...

Embodiment 3

[0112] 1. Effect of LCD domain on tumor cell proliferation

[0113] Using the constructed LCD1 or LCD2 knockout stable cell lines, CCK8 was used to detect the proliferation ability of various cells. The specific implementation steps are as follows:

[0114] (1) Inoculate the suspension of stably transfected cells (HEK293T or PANC1) in a 96-well plate, pre-culture for 24 hours, and set up a blank group and a control group at the same time;

[0115] (2) Add 10 μL of CCK-8 Solution to each well, add along the cell plate wall, mix gently, do not produce air bubbles, and incubate in the incubator for 2 h;

[0116] (3) Measure the absorbance at 450 nm with a microplate reader.

[0117] During the experiment, the relative activity of the cells was detected on the 0th day, the 1st day, the 3rd day and the 5th day, and the results were as follows: Figure 12 and Figure 13 shown. Results analysis, in HEK293T ( Figure 12 ), the cell proliferation of the LCD knockout group (includ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of KMT2D in the preparation of antitumor drugs, and belongs to the technical field of biological medicines. A protein structure of KMT2D is analyzed through a bioinformatics means, two essentially disordered structures LCD1 and LCD2 of the KMT2D protein are finally obtained through screening, and the influence of the two structures on the KMT2D function is researched by combining the gene editing technology, the change (including mRNA and protein levels) of a KMT2D enzymatic complex is further researched, and thereby a foundation is laid for the deep understanding of a mechanism of KMT2D promoting tumor.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to the application of KMT2D in the preparation of antitumor drugs. Background technique [0002] Histone-lysine N-methyltransferase 2D (Histone-lysine N-methyltransferase 2D, KMT2D) is a methyltransferase of histone H3K4. In most mammals, histone methylation It mainly exists in the enhancer and promoter regions of transcribed genes, and is closely related to gene transcription activity. Enhancer methylation leads to the recruitment of other coactivators, promotes the activation of target gene RNA polymerase II, and ultimately controls gene transcription, and can interact with lysine demethylases (KDM) to selectively regulate genes transcription. KMT2D gene contains 54 exons and 53 introns, belongs to the family member of lysine methyltransferase 2 (Lysine methyltransferase 2, KMT2), and is highly conserved throughout the evolution of eukaryotes. [0003] The KMT2D...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/45A61P35/00
CPCA61K38/45C12Y201/01043A61P35/00
Inventor张二浩
OwnerNANTONG UNIVERSITY