Carbon catabolism regulation protein CcpA mutant I42A

A technology for catabolism and protein regulation, which is applied in the field of recombinant expression vectors and recombinant microbial cells, and can solve the problems of destroying bacterial metabolic pathways and restricting bacterial growth.

Active Publication Date: 2020-12-11
JIANGNAN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Therefore, at present, it is generally believed in the field that simply knocking out the carbon catabolism regulatory protein will limit the growth of the bacteria, destroy the metabolic pathways of the bacteria, and often fail to obtain the expected results. With the advancement of protein engineering, the rationality of protein Retrofitting is becoming more and more popular

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbon catabolism regulation protein CcpA mutant I42A
  • Carbon catabolism regulation protein CcpA mutant I42A
  • Carbon catabolism regulation protein CcpA mutant I42A

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The selection of the key amino acid of embodiment 1 bacillus licheniformis CcpA protein

[0037] As a global regulatory factor, the CcpA gene of Bacillus licheniformis mainly binds to the nucleic acid site through the protein and then exerts its regulatory function. After the CcpA protein binds to the nucleic acid, the relative position of the substructure of the corresponding binding site will change to a certain extent. The amino acids that act as fulcrums in this transformation process may be located at both ends of the α-helix in the substructure of CcpA protein. At the same time, the binding of CcpA protein to nucleic acid requires the recognition of the protein and the cre site, and the amino acid that plays a major role in the recognition of the protein and the cre site may be located in the middle of the α helix, so when we select the amino acid site, it is mainly distributed in the CcpA protein α Both ends of the spiral and the middle.

Embodiment 2

[0038] The construction of embodiment 2 bacillus licheniformis CcpA protein expression vector

[0039] Using the Bacillus licheniformis CcpA protein genome as a template, the CcpA gene was amplified, and the resulting gene was connected to the pET28a vector to construct the Bacillus licheniformis CcpA protein expression vector ( image 3 ). Transform it into Escherichia coli BL21(DE3) to construct a recombinant strain.

Embodiment 3

[0040] Example 3 Site-directed Mutagenesis, Expression and Purification of Bacillus licheniformis CcpA Protein

[0041] The Bacillus licheniformis CcpA protein expression vector constructed in Example 2 was used as a template to perform site-directed mutation on the Bacillus licheniformis CcpA protein. The mutation primers used were:

[0042] I42A-F (SEQ ID NO. 3): 5'aaggtgcttgaagccgccgagcgtcttggctatcgtccaaatgccgtggc3';

[0043] I42A-R (SEQ ID NO. 4): 3'agccaagacgctcggcggcttcaagcaccttctttctcgtcgtcggcttg5'.

[0044] The CcpA protein after site-directed mutation (the amino acid sequence is shown in SEQ ID NO.2, and the gene nucleotide sequence encoding it is shown in SEQ ID NO.1) was heterologously expressed and purified in Escherichia coli, and the colonies were amplified by PCR. The verification diagram is as follows figure 1 As shown, the SDS-PAGE gel verification picture is as follows figure 2 As shown, it indicates that the mutated CcpA protein was successfully transform...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a carbon catabolism regulation protein CcpA mutant I42A, and belongs to the technical field of protein engineering. A CcpA gene cloned from a bacillus licheniformis genome is mutated to obtain a carbon catabolism regulation protein CcpA mutant I42A, wherein the amino acid sequence of the mutant I42A is as shown in SEQ ID NO.2, and the nucleotide sequence of the gene for encoding the mutant I42A is as shown in SEQ ID NO.1. According to the invention, a recombinant expression vector containing the CcpA mutant I42A gene is constructed, and the constructed expression vectoris transformed into a bacillus licheniformis CcpA gene defective strain to obtain recombinant bacillus licheniformis. The obtained recombinant bacillus licheniformis can obviously change the carbon catabolism repression phenomenon caused by the existence of glucose, and can reduce the preference of bacillus licheniformis to xylose.

Description

technical field [0001] The invention belongs to the field of protein engineering, relates to a carbon catabolism regulating protein CcpA mutant I42A, also relates to a recombinant expression vector and a recombinant microbial cell expressing the mutant, and further relates to the effect of the mutant on Dangwood in the fermentation process of Bacillus licheniformis Effects of sugar on xylose utilization when co-existing with glucose. Background technique [0002] Bacillus licheniformis (Bacillus licheniformis) is a Gram-positive bacterium with the advantages of heat resistance, rich enzyme system, high enzyme production, moderate growth rate, protein folding, and genome-wide information disclosure. Compared with Escherichia coli, Bacillus licheniformis has the advantages of high heat resistance, low pH tolerance, and high biomass. Therefore, it is not only widely used as a host for exogenous gene expression, but also has great potential in the fermentation industry. potenti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/32C12N15/31C12N15/75C12N1/21C12R1/10
CPCC07K14/32C12N15/75
Inventor石贵阳李由然张玉鹏肖丰旭王瀚容张梁丁重阳徐沙顾正华
OwnerJIANGNAN UNIV