Gene mutant of low-cadmium-accumulation control gene ZmCd1 of corn grains, molecular marker for gene mutant and application of gene mutant

A technology of molecular markers and low accumulation, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of inaccurate identification, shorten the process of identification and breeding, improve breeding efficiency, and be suitable for popularization and application

Active Publication Date: 2020-12-11
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES +1
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this molecular marker is aimed at the insertion mutation at the promoter position of the ZmCd1 gene, so other mutations cannot be accurately identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene mutant of low-cadmium-accumulation control gene ZmCd1 of corn grains, molecular marker for gene mutant and application of gene mutant
  • Gene mutant of low-cadmium-accumulation control gene ZmCd1 of corn grains, molecular marker for gene mutant and application of gene mutant
  • Gene mutant of low-cadmium-accumulation control gene ZmCd1 of corn grains, molecular marker for gene mutant and application of gene mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Obtaining of Maize ZmCd1 Gene Mutant ZmCd1-2

[0033] The method for measuring the cadmium content in corn kernels is as follows: corn is planted in cadmium-contaminated farmland (cadmium content is 1.8±0.3mg / kg), and the experiment adopts random block design, with four independent repetitions. For each independent repetition, the same maize inbred line was planted in a row, 10 plants were planted in a row, and the row length was 3m. The row spacing of each interbreeding line is 60cm. Maize ears were dried and threshed after maturity. For each repetition of each inbred line, 1 kg of kernels were dried and crushed, passed through a 100-mesh sieve, and then digested with nitric acid-perchloric acid. Finally, ZEEnit700P atomic absorption spectrometer was used for graphite furnace Determination of cadmium content (mg / kg) in digestive juice (Wu Jiamei, 2019, Journal of Agro-Environment Science, 38:502-509). Data from the four environments were integrated using Be...

Embodiment 2

[0035] Example 2 cDNA sequence analysis of the allelic variation ZmCd1-2 controlling the low accumulation of cadmium in corn grain

[0036] RNA was extracted from Ky21 maize leaves by TRIZOL method, and RNA was reverse transcribed into cDNA by reverse transcription kit (Takara). Using the 3'-RACE kit (Takara) and the 1219F primer located on the 4th exon (Table 1), the transcript sequence behind the 4th exon and the complete 3' end sequence were obtained. Compared with B73, sequencing analysis found that there were two shorter transcripts of ZmCd1-2 in Ky21. The fifth exon of the first transcript was not transcribed, and a 130 bp transposon insertion sequence and a 9 bp intronic sequence were exonized after the fourth exon. The 5th exon in the second transcript is also not transcribed, and a 216 bp transposon insertion after the 4th exon is exonized (see figure 2 ).

[0037] Table 1 is located on the 4th exon and is used for the amplification primer of ZmCd1-2 gene cDNA 3'-...

Embodiment 3

[0039] Example 3 Development and Application of Specific Functional Molecular Markers of Maize ZmCd1 Gene Mutant ZmCd1-2

[0040] Based on the sequence difference between the high cadmium accumulation corn inbred line Ky21 and the low cadmium accumulation corn inbred line B73 in the fourth intron of the ZmCd1 gene, a PCR functional molecular marker PCR-ZmCd1-2 was developed, and its primer information is shown in Table 2. Using 204F / 732R / 965R primers, the amplified fragment size was 965bp in the high cadmium accumulation maize inbred line Ky21, and the amplified fragment size was 529bp in the low cadmium accumulation maize inbred line B73 ( image 3 ).

[0041] Table 2 PCR-ZmCd1-2 functional molecular marker primer information

[0042] Primer 5'-3' sequence 204F GACGTTCTGGAGTCGCTGG 965R ACGTCAAGCAGATAAGGGCC 732R GGTCCTACAGTCGTCCGAGA

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of botanical molecular biology and particularly relates to a gene mutant of a low-cadmium-accumulation control gene ZmCd1 of corn grains, a molecular marker for the gene mutant and application of the gene mutant. According to the gene mutant ZmCd1-2 of the corn ZmCd1, provided by the invention, compared with a wild type gene ZmCd1, transposon-12959bp insertion mutation presents after a ninth base of a fourth intron, and the mutation is related to high cadmium accumulation of corn. The invention provides the molecular marker for detecting the mutation and a specific primer for detecting the molecular marker, and the molecular marker and the specific primer can be applied to screening and identification of ZmCd1-2-mutation-type high-cadmium-accumulation corn and can also be applied to cadmium-accumulation improvement breeding of ZmCd1-2-type corn grains.

Description

technical field [0001] The invention relates to the technical field of plant molecular biology, in particular to a ZmCd1 gene mutant of the low-accumulation control gene ZmCd1 in corn grains and its molecular marker and application. Background technique [0002] Cadmium is an important industrial raw material, but also one of the most toxic and widely distributed heavy metal pollutants. According to the concentration of cadmium, soil cadmium pollution can be divided into three grades: mild (0.3-0.6mg / kg), moderate (0.6-0.9mg / kg) and severe (above 0.9mg / kg). The national food safety standard (GB2762-2017) stipulates that the limit index of cadmium pollutants in grains and their products is less than 0.1mg / kg. [0003] Maize is the largest food crop in my country, with a large planting area, a wide range of planting, and large genetic variation among varieties. Previous studies have shown that there are significant differences in cadmium accumulation ability among different ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156
Inventor骆美洁赵衍鑫汤彬赵久然宋伟张云霞郭欢乐陈志辉
OwnerBEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES