Method for improving moisture resistance of cabbage type rape
A Brassica napus, moisture tolerance technology is applied in the fields of rapeseed quality breeding and rapeseed transgenic breeding, and achieves the effects of time-consuming, cost reduction, manpower and economic cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0039] according to figure 1 It can be known that the present invention will be described in further detail.
[0040] A method for improving the moisture resistance of Brassica napus, the specific steps are:
[0041] A. Construction of expression vectors containing NPTII (kanamycin resistance gene) expression elements, Bar (glufosinate resistance gene) expression elements and target gene vgb (gene encoding Vitiligo hyaline hemoglobin)
[0042] 1. Use the vgb sequence published on the NCBI website (Genebank number: GBEU363512.1) as a template to design primers (forward primer: 5'GACGAGCTCATGTTAGACCAGCAAACCAT3'; reverse primer:
[0043] 5'GACATCTAGATTATTCAACCGCTTGAGCGT3'), PCR amplification was performed using plasmid DNA (pPZV, see Genetic Resources Table) as substrate.
[0044] PCR reaction system: the total volume is 50 μL, which contains 5 μL substrate DNA (50ng / μL), 5 μL 10×Taq Buffer (containing Mg2+), 1 μL dNTPs (10 mmol / L), 1U EX-Taq DNA polymerase (TaKaRa), 100ng eac...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com