Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel resistant gene of chloromycetin and application of novel resistant gene of chloromycetin

A resistance gene and a new technology are applied to the new resistance gene of chloramphenicol and its application field, and can solve the problems such as the ineffectiveness of Gram-positive cocci.

Active Publication Date: 2020-12-22
SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the effect on typhoid bacillus, influenza bacillus, parainfluenza bacillus and pertussis bacillus is stronger than other antibiotics, and it is also effective against rickettsial infections such as typhus, but its effect on gram-positive cocci is not as good as that of penicillin and tetracycline

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel resistant gene of chloromycetin and application of novel resistant gene of chloromycetin
  • Novel resistant gene of chloromycetin and application of novel resistant gene of chloromycetin
  • Novel resistant gene of chloromycetin and application of novel resistant gene of chloromycetin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] 1. Material method

[0021] 1. Choose a suitable carrier

[0022] Select the pBBR1MCS-2 plasmid as figure 1 Shown is a schematic diagram of the pBBR1MCS-2 plasmid, which is a broad host protein expression and cloning plasmid with high copy, multiple cloning sites, stable expression and constitutive plasmid properties.

[0023] 2. Design of primers for digestion

[0024] upstream primer

[0025]

[0026] downstream primer

[0027] TCCCCCGGGCTGCAG GAATTC TCAGTGGCTTCTTCGGATCA

[0028] GAATTC Indicates the EcoRI restriction site, represents the SD sequence, which has the function of enhancing gene expression, Indicates the additionally added start codon sequence to prevent the inserted foreign sequence gene from not replicating.

[0029] The promoter sequence is the lac promoter that comes with the plasmid pBBR1-MCS2, tttacactttatgcttccggctcgtatgttg

[0030] 3. Construction of recombinant vector

[0031] 3.1 Acquisition of target gene GMC

[0032] Polymer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel resistant gene of chloromycetin and application of the novel resistant gene of chloromycetin. The resistant gene has a sequence shown in SEQ ID No. 1 and is called aftera gene GMC; after tertiary sequencing of a genome, a drug-resistant gene known at present is not discovered on the genome, and then, through sequencing of RNA, it is discovered that GMC-encoded oxidoreductase has a very high transcription expression level in the presence of antibiotics. According to the novel resistant gene provided by the invention, a potential drug-resistant gene of the chloromycetin is discovered, help is provided for learning about a drug resisting mechanism of the chloromycetin and supplementing a drug resisting database, and a target point is provided for resisting drugresistance to the chloromycetin afterwards.

Description

technical field [0001] The invention belongs to the field of biotechnology, and particularly relates to a novel resistance gene of chloramphenicol and its application. Background technique [0002] Chloramphenicol antibiotics can act on the 50S subunit of the bacterial ribosome and block protein synthesis. They are broad-spectrum bacteriostatic antibiotics. The 70S ribosome of bacterial cells is the main cellular component of protein synthesis, and it includes two subunits, 50S and 30S. Chloramphenicol binds reversibly to the 50S subunit, blocks the action of transpeptidylase, and interferes with the binding of aminoacyl-tRNA terminals with amino acids to the 50S subunit, thereby hindering the formation of new peptide chains and inhibiting protein synthesis . Because chloramphenicol can also combine with 70S of human mitochondria, it can also inhibit the protein synthesis of human mitochondria, which is toxic to the human body. Because the binding of chloramphenicol to th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/70C12N1/21C12R1/19
CPCC07K14/195C12N15/70Y02A50/30
Inventor 李炳张家禹徐结
Owner SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com