Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of circular RNA circ-FoxO3 in preparation of products for preventing and treating cerebral arterial thrombosis

A circ-foxo3, rnacirc-foxo3 technology, applied in the field of biotechnology and ischemic stroke, can solve the problems of lack of reliable therapeutic target sites, limited patient prognosis, complex pathological mechanisms, etc., to protect the integrity of the blood-brain barrier , the effect of reducing the probability of hemorrhagic transformation

Active Publication Date: 2021-01-01
THE FIRST AFFILIATED HOSPITAL OF JINAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complex pathological mechanism of ischemic stroke and the lack of reliable therapeutic targets, the prognosis of patients is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of circular RNA circ-FoxO3 in preparation of products for preventing and treating cerebral arterial thrombosis
  • Application of circular RNA circ-FoxO3 in preparation of products for preventing and treating cerebral arterial thrombosis
  • Application of circular RNA circ-FoxO3 in preparation of products for preventing and treating cerebral arterial thrombosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Expression level of circ-FoxO3 in cerebrovascular endothelial cells

[0062] 1. Introduction to Circ-FoxO3 information

[0063] The circular RNA is highly conserved, and is a circular RNA generated by reverse shearing of the second exon of the FoxO3 gene in the species derived from humans or mice. in:

[0064] The mouse-derived circ-FoxO3 is also called mmu_circ_0002207, and its length is 1436bp. Its corresponding parental gene is located at chr10:41916271-41917707, and its reverse splicing site is GGGCAAAGCAG / (splicejunction)AACTCCATCCGGCACA (SEQ ID NO:11).

[0065] The human circ-FoxO3 is also called hsa_circ_0006404, with a length of 1435bp; its corresponding parental gene is located at chr6: 108984657-108986092, and its reverse splicing site is also SEQ ID NO: 11 ( figure 1 A).

[0066] Mouse-derived circ-FoxO3 (SEQ ID NO:1):

[0067]AACTCCATCCGGCACAACCTGTCCCTGCACAGCCGCTTCATGCGCGTT CAGAATGAAGGCACGGGCAAGAGCTCTTGGTGGATCATCAACCCCGATGG GGGAAAGAGCGGGAAGGCCC...

Embodiment 2

[0109] Example 2 Localization of circ-FoxO3 in cerebrovascular endothelial cells

[0110] (1) In order to detect the localization of circ-FoxO3 in cerebrovascular endothelial cells, the present invention adopts FISH and immunofluorescence experiments. The primary antibody used in this part is anti-Rabbit-CD31 (Abcam, ab28364), the secondary antibody used is Goat anti-Rabbit IgG, Alexa Fluor Plus 488 (Invitrogen, A32731), and the circ-FoxO3 probe used is CY5-TGTGCCGGATGGAGTTCTGCTTTGCCCACTTC (SEQ ID NO:16), and the control probe was provided by Shanghai Sangon Bioengineering Company. The specific method is as follows:

[0111] Mouse in vivo experiment: C57BL / 6 mice (3 male and female, 8 weeks, 25 ± 2g, provided by the Experimental Animal Center of Southern Medical University) were treated with MCAO for 3 hours and then perfused for 3 hours (the specific method is the same as in Example 1 MCAO / R experiment), and then the brain tissue was taken, and the endothelial cell markers ...

Embodiment 3

[0139] Example 3 Knockdown or overexpression of circ-FoxO3 in endothelial cell lines and detection of its expression level under OGD / R conditions

[0140] (1) Knock down circ-FoxO3

[0141] Taking bEnd.3 and HBMEC as the research object, using Lipofectamine produced by Invitrogen TM StemTransfection Reagent transfected interference sequences (SEQ ID NO:12-15) to obtain cells with low expression of circ-FoxO3, and then refer to Example 1 to carry out OGD / R experiments.

[0142] The nucleotide sequence of the interfering RNA sequence for knocking down circ-FoxO3 is as follows:

[0143] Sense strand: 5'-GGGCAAAGCAGAACUCCAUUU-3' (SEQ ID NO: 12);

[0144] Antisense strand: 5'-AUGGAGUUCUGCUUUGCCCUU-3' (SEQ ID NO: 13);

[0145]The sense strand of the control sequence: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 14);

[0146] Antisense strand of the control sequence: 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 15);

[0147] The specific experimental process is as follows:

[0148] ①The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology and cerebral arterial thrombosis, and particularly relates to application of circular RNA circ-FoxO3 in preparation of products for preventing and treating cerebral arterial thrombosis. The circular RNA is highly conservative and has the same reverse shearing site in human-derived or mouse-derived species. The application proves that the circ-FoxO3 is highly expressed in cerebrovascular endothelial cells of a MCAO / R mouse and the cerebrovascular endothelial cell line subjected to OGD / R treatment; A certain effect of the circ-FoxO3 in the endothelial barrier treated by OGD / R is shown by knockdown or over-expression of the circFoxO3. The application of the circular RNA circ-FoxO3 provides a new thought for prevention of hemorrhagic transformation after acute ischemic stroke, and provides a new target for development of a neurovascular protective agent.

Description

technical field [0001] The invention belongs to the fields of biotechnology and ischemic stroke, and specifically relates to the application of a circular RNA circ-FoxO3 in the preparation of products for the prevention and treatment of ischemic stroke. Background technique [0002] Ischemic stroke is a multiple disease in which intracranial vascular stenosis or occlusion and blood supply disturbance are induced by various factors, eventually leading to brain tissue necrosis and nervous system dysfunction. Blood-brain barrier injury is a common symptom of acute ischemic stroke, and it is also one of the causes of hemorrhagic transformation in ischemic stroke. Hemorrhagic transformation of ischemic stroke refers to the phenomenon of intracranial hemorrhage in patients with no hemorrhage in the early diagnosis but with the natural course of the disease or after treatment. A large number of studies have confirmed that the ischemic and hypoxic microenvironment formed by ischemi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7088A61P9/10A61P25/00C12N15/113C12Q1/6883
CPCA61K31/7088A61P9/10A61P25/00C12N15/113C12N2310/113C12Q1/6883C12Q2600/158C12Q2600/178C12N2310/14
Inventor 杨振国李玉峰臧健坤逯丹徐安定
Owner THE FIRST AFFILIATED HOSPITAL OF JINAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products