Application of circular RNA circ-FoxO3 in preparation of products for preventing and treating cerebral arterial thrombosis
A circ-foxo3, rnacirc-foxo3 technology, applied in the field of biotechnology and ischemic stroke, can solve the problems of lack of reliable therapeutic target sites, limited patient prognosis, complex pathological mechanisms, etc., to protect the integrity of the blood-brain barrier , the effect of reducing the probability of hemorrhagic transformation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1 Expression level of circ-FoxO3 in cerebrovascular endothelial cells
[0062] 1. Introduction to Circ-FoxO3 information
[0063] The circular RNA is highly conserved, and is a circular RNA generated by reverse shearing of the second exon of the FoxO3 gene in the species derived from humans or mice. in:
[0064] The mouse-derived circ-FoxO3 is also called mmu_circ_0002207, and its length is 1436bp. Its corresponding parental gene is located at chr10:41916271-41917707, and its reverse splicing site is GGGCAAAGCAG / (splicejunction)AACTCCATCCGGCACA (SEQ ID NO:11).
[0065] The human circ-FoxO3 is also called hsa_circ_0006404, with a length of 1435bp; its corresponding parental gene is located at chr6: 108984657-108986092, and its reverse splicing site is also SEQ ID NO: 11 ( figure 1 A).
[0066] Mouse-derived circ-FoxO3 (SEQ ID NO:1):
[0067]AACTCCATCCGGCACAACCTGTCCCTGCACAGCCGCTTCATGCGCGTT CAGAATGAAGGCACGGGCAAGAGCTCTTGGTGGATCATCAACCCCGATGG GGGAAAGAGCGGGAAGGCCC...
Embodiment 2
[0109] Example 2 Localization of circ-FoxO3 in cerebrovascular endothelial cells
[0110] (1) In order to detect the localization of circ-FoxO3 in cerebrovascular endothelial cells, the present invention adopts FISH and immunofluorescence experiments. The primary antibody used in this part is anti-Rabbit-CD31 (Abcam, ab28364), the secondary antibody used is Goat anti-Rabbit IgG, Alexa Fluor Plus 488 (Invitrogen, A32731), and the circ-FoxO3 probe used is CY5-TGTGCCGGATGGAGTTCTGCTTTGCCCACTTC (SEQ ID NO:16), and the control probe was provided by Shanghai Sangon Bioengineering Company. The specific method is as follows:
[0111] Mouse in vivo experiment: C57BL / 6 mice (3 male and female, 8 weeks, 25 ± 2g, provided by the Experimental Animal Center of Southern Medical University) were treated with MCAO for 3 hours and then perfused for 3 hours (the specific method is the same as in Example 1 MCAO / R experiment), and then the brain tissue was taken, and the endothelial cell markers ...
Embodiment 3
[0139] Example 3 Knockdown or overexpression of circ-FoxO3 in endothelial cell lines and detection of its expression level under OGD / R conditions
[0140] (1) Knock down circ-FoxO3
[0141] Taking bEnd.3 and HBMEC as the research object, using Lipofectamine produced by Invitrogen TM StemTransfection Reagent transfected interference sequences (SEQ ID NO:12-15) to obtain cells with low expression of circ-FoxO3, and then refer to Example 1 to carry out OGD / R experiments.
[0142] The nucleotide sequence of the interfering RNA sequence for knocking down circ-FoxO3 is as follows:
[0143] Sense strand: 5'-GGGCAAAGCAGAACUCCAUUU-3' (SEQ ID NO: 12);
[0144] Antisense strand: 5'-AUGGAGUUCUGCUUUGCCCUU-3' (SEQ ID NO: 13);
[0145]The sense strand of the control sequence: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 14);
[0146] Antisense strand of the control sequence: 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 15);
[0147] The specific experimental process is as follows:
[0148] ①The...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


