Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant microorganism for producing sialic acid and application of recombinant microorganism

A technology for recombining microorganisms and sialic acid, applied in the direction of microorganisms, microorganism-based methods, recombinant DNA technology, etc., can solve problems such as difficult to meet industrial production and low yield of sialic acid

Active Publication Date: 2021-01-05
TSINGHUA UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the yield of sialic acid produced by the existing fermentation method is still very low, which is difficult to meet the needs of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075]Example 1 Construction of starting strain

[0076]In this example, E. coli BL21 was used as an example to construct a starting strain capable of synthesizing sialic acid, specifically: knocking out the nanATEK gene cluster in E. coli BL21 (purchased from the China Industrial Microbial Culture Collection) and introducing the overexpression plasmid pXMJ at the same time -neuBC, to obtain the starting strain BL21△nanATEK / pXMJ-neuBC capable of producing sialic acid.

[0077]1. Knockout of nanATEK

[0078]Use Red recombination method to knock out nanATEK (gene cluster sequence is shown in SEQ ID NO.16), the specific method is as follows: use nan-F (ggtataacaggtataaaggtatatcgtttatcagacaagcatcacttcagaggtatttgtgtaggctggagctgcttc) and nan-R (tcataatttccgcgcgccAddcatcagtcagtcagtcagcat from Daccaccaccgcagcgcgcgcgcgcc) and nan-R (tcataatttccgcgcgcgcgcc) as the plasmid gaccatcagcc A PCR fragment of 1.3Kb was obtained for template amplification, and the fragment was transferred into E. coli BL21 con...

Embodiment 2

[0083]Example 2 Construction of recombinant bacteria overexpressing glucosamine 6-phosphate synthase or its mutants

[0084]On the basis of the starting strain constructed in Example 1, the glucosamine 6-phosphate synthase (amino acid sequence is shown in SEQ ID NO. 1 and the coding gene sequence is shown in SEQ ID NO. 2) or its mutants were further overexpressed E15K+D387V+S450P+E525G (amino acid sequence is shown in SEQ ID NO.11, coding gene sequence is shown in SEQ ID NO.12), the specific method is as follows:

[0085]1. Construction of a plasmid that overexpresses glucosamine 6-phosphate synthase glmS or its mutant glmS*

[0086]The artificially synthesized glmS* mutant gene, whose sequence is shown in SEQ ID NO.12, contains the following mutation E15K compared with glmS derived from E. coli W3110 (wild-type glmS, the sequence is shown in SEQ ID NO.2), D387V, S450P, E525G, compared with wild-type glmS, the enzyme activity is higher and is not inhibited by acetylglucosamine. Insert neuBC ...

Embodiment 3

[0089]Example 3 Construction of recombinant bacteria that simultaneously overexpress glucosamine 6-phosphate synthase and fructose-1,6-bisphosphate

[0090]Fructose-1,6-bisphosphate can catalyze the dephosphorylation of fructose-1,6-bisphosphate to produce fructose 6-phosphate. The present invention finds that it is further based on overexpression of 6-phosphate glucosamine synthase or its mutants. Overexpression of fructose-1,6-bisphosphatase glpX can further increase the production of sialic acid.

[0091]At the same time overexpression of E. coli 6-phosphate glucosamine synthetase (amino acid sequence is shown in SEQ ID NO. 1, coding gene sequence is shown in SEQ ID NO. 2) or its mutant (amino acid sequence is shown in SEQ ID NO. As shown, the coding gene sequence is shown in SEQ ID NO. 12) and fructose-1,6-bisphosphate (amino acid sequence is shown in SEQ ID NO. 3, and the coding gene sequence is shown in SEQ ID NO. 4) The construction method of recombinant bacteria is as follows:

[009...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of microbial fermentation, and in particular relates to a recombinant microorganism for producing sialic acid and application of the recombinant microorganism. Compared with a starting strain capable of synthesizing sialic acid, the recombinant microorganism provided by the invention has increased expression of 6-phosphoglucosamine synthetase or a mutant thereof and increased expression of fructose-1,6-diphosphate esterase and / or glutamine synthetase. According to the invention, the recombinant microorganism capable of producing sialic acid by taking cheap carbon sources, such as glucose and glycerol, as raw materials through fermentation is obtained by modifying the microorganism; the sialic acid yield of the recombinant microorganism is remarkably improved; efficient conversion from the cheap carbon sources, such as glucose and glycerol, to sialic acid is realized; the production cost of sialic acid is remarkably reduced; and the recombinant microorganism has important industrial application value.

Description

Technical field [0001] The invention relates to the technical field of microbial fermentation, and in particular to a recombinant microorganism that produces sialic acid and its application. Background technique [0002] Sialic acid, also known as N-acetylneuraminic acid, is an important physiologically active substance in the human body and the main component of gangliosides and glycoproteins in the brain. Sialic acid is the most important functional ingredient in the traditional Chinese rare food bird's nest. It is also one of the components in maternal colostrum that plays an important role in the early brain development and improvement of the immune system of infants. Research has found that sialic acid is an indispensable nutrient for brain development. Sialic acid is closely related to the normal development of the baby's brain. Supplementing sialic acid is beneficial to the formation of human learning and memory. At present, sialic acid has been widely used in infant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/77C12P19/26C12R1/19C12R1/15
CPCC12N9/00C12N9/16C12N15/77C12N15/70C12P19/26
Inventor 陈振刘德华
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com