Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof

A detection kit and protein antigen technology, applied in the field of protein detection, can solve the problems of limited, no ANR1 and ANR2 antibodies for sale, and inability to detect expression, etc., to achieve the effect of strong immunogenicity

Active Publication Date: 2021-01-05
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current research on ANR1 and ANR2 protein level is still limited, and there are no commercial antibodies against ANR1 and ANR2 for sale, and their expression at the protein level cannot be dete

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof
  • Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof
  • Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0044]The present invention provides an antibody against tea tree anthocyanin reductase 1 and anthocyanin reductase 2 protein antigens, which are produced by immunizing animals with the aforementioned immune antigens. The antibodies preferably include monoclonal antibodies and polyclonal antibodies. The preparation method of the polyclonal antibody preferably includes the following steps: dilute the above immune antigen to 1 mg / mL, emulsify it with Freund’s complete adjuvant at a volume ratio of 1:1, and subcutaneously on the back of the neck of two New Zealand white rabbits. Carry out multi-point injections (1mL each) for immunization, 4 times of immunization, 2 weeks apart each time, and blood collection to detect antibody titer by ELISA method; after the antibody titer reaches 1:80,000, the serum is collected and purified, ELISA and western After identification by blot, polyclonal antibodies against ANR1 and ANR2 were obtained. When the antibody is a monoclonal antibody, the pres...

Example Embodiment

[0048]Example 1 Design and synthesis of ANR1 and ANR2 protein polypeptides

[0049](1) According to the ANR1 and ANR2 gene sequences (SEQID No.3~No.4) cloned in Yinghong No. 9 and Nankunshan Maoye Tea Plants, Blast search on GenBank to obtain ANR1 and ANR2 in different tea plant resources gene.

[0050]ANR1 gene sequence (SEQ ID No.3):

[0051]ATGGAAGCCCAACCGACAGCTCCGAAGGCCGCATGTGTTGTTGGTGGCACCGGCTTCGTGGCGGCGACGCTCATCAAGTTGTTGCTTGAGAAAGGCTATGCGGTCAACACCACTGTCCGAGACCCAGGCAATCAGAAAAAGACCTCTCACCTTCTAGCACTAAAGGGTTCAGGCAACCTAAAAATCTTCCGAGCAGACCTCACCGATGAACAGAGCTTTGACGCCCCTGTAGCGGGTTGTGACCTGGTCTTCCATGTCGCTACACCAGTCAACTTTGCTTCCGAGGATCCAGAGAATGACATGATAAAACCAGCAATTCAAGGAGTAGTCAATGTTCTAAAAGCTTGTGCAAAAGCAGGAACGGTTAAACGTGTCATTTTAACATCATCAGCAGCTGCTGTATCGATCAATAAGCTCAATGGGACCGGCCTGGTCATGGATGAGAGTCACTGGACTGACACCGAGTTTTTGAATTCTGCGAAGCCGCCCACTTGGGGGTACCCTTTATCGAAAACACTAGCTGAGAAAGCTGCTTGGAAGTTTGCCGAAGAAAATAACATTAATCTTATCACTGTCATCCCAACTCTCATGGCCGGTCCGTCACTTACTGCAGATGTCCCTAGCAGTATTGGTCTTGCCATGTCCTTGATCACAGGGAAT...

Example Embodiment

[0057]Example 2

[0058]1. ANR1 and ANR2 protein antigen peptide preparation and immune method

[0059]1. ANR1 protein antigen peptide (NQKKTSHLLALKGS) and ANR2 antigen peptide (NFASEDPENDMIKPA) were synthesized by Qiangyao Biological Company.

[0060]2. Both ANR1 and ANR2 antigen peptides are coupled with KLH and BSA to prepare immune antigens and detection antigens

[0061](1) Use SMCC kit (purchased from Thermo Fisher Scientific) to couple ANR1 and ANR2 antigen peptides to KLH respectively (coupling agent is Sulfo-SMCC) to prepare immune antigens, the specific method is: weigh 4mg ANR1 and ANR2 antigen peptides Dissolve in 0.4mL PBS (pH 7.2, the same below), add 4mg Sulfo-SMCC, incubate at 4℃ for 2h, then add 25mg KLH solution (concentration 20mg / mL) in ANR1-SMCC and ANR2-SMCC respectively , Reacted at 4℃ for 2h, and dialyzed in PBS buffer for 24h to obtain ANR1-KLH and ANR2-KLH immune antigens, and stored at -20℃.

[0062]A BCA kit (purchased from Thermo Fisher Scientific) was used to determin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of protein detection, and particularly relates to a tea tree anthocyanin reductase protein antigen polypeptide and an antibody, detection kit and application thereof. The tea tree anthocyanin reductase protein antigen polypeptide is at least one of tea tree anthocyanin reductase 1 antigen polypeptide and anthocyanin reductase 2 protein antigen polypeptide, wherein the amino acid sequence of the tea tree anthocyanin reductase 1 antigen polypeptide is shown as SEQ ID No. 1, and the amino acid sequence of the tea tree anthocyanin reductase 2 antigen polypeptide is shown as SEQ ID No. 2. The invention also provides an immune antigen and detection antigen of the tea tree anthocyanin reductase protein and an antibody for resisting the tea tree anthocyanin reductase protein antigen. The antibody not only can lay a foundation for functional research of the protein, but also has positive reference significance for subsequent research on metabolism offlavonoids and other substances in tea trees.

Description

technical field [0001] The invention belongs to the technical field of protein detection, and in particular relates to a tea tree anthocyanin reductase protein antigen polypeptide, an antibody thereof, a detection kit and application thereof. Background technique [0002] Anthocyanidin reductase 1 (Anthocyanidin reductase 1, ANR1) and anthocyanidin reductase 2 (Anthocyanidin reductase 2, ANR2), ANR1 and ANR2 are one of the structural enzymes in the metabolic pathway of flavonoid biosynthesis. Both ANR1 and ANR2 can catalyze cyanidin into catechin (C) and epicatechin (EC), and delphinidin into gallocatechin (GC) and epigallocatechin (EGC), Thus, both ANR1 and ANR2 have epimerase activity. ANR1 and ANR2 are not only the key enzymes of anthocyanin metabolism in plants, but also play a key regulatory role in the synthesis and accumulation of catechins in plants. However, the content of flavonoids such as anthocyanins and catechins in tea trees will vary due to different growth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/02C07K19/00C07K16/40C07K16/06C12N5/20G01N33/577G01N33/573
CPCC07K16/06C07K16/40C07K2319/31C12N9/001C12Y103/01077G01N33/573G01N33/577G01N2333/90206
Inventor 陈忠正黄秋灿施婧李斌张媛媛林晓蓉
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap