Supercharge Your Innovation With Domain-Expert AI Agents!

Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof

A detection kit and protein antigen technology, applied in the field of protein detection, can solve the problems of limited, no ANR1 and ANR2 antibodies for sale, and inability to detect expression, etc., to achieve the effect of strong immunogenicity

Active Publication Date: 2021-01-05
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current research on ANR1 and ANR2 protein level is still limited, and there are no commercial antibodies against ANR1 and ANR2 for sale, and their expression at the protein level cannot be detected, and the relationship between ANR1 and ANR2 cannot be revealed at the protein expression level Regulation of synthesis of anthocyanins and catechins in different species, tissues and parts of tea trees

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof
  • Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof
  • Tea tree anthocyanin reductase protein antigen polypeptide as well as antibody, detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0044] The invention provides an antibody against tea tree anthocyanin reductase 1 and anthocyanin reductase 2 protein antigens, which is produced by immunizing animals with the above immune antigens. The antibodies preferably include monoclonal antibodies and polyclonal antibodies. The preparation method of the polyclonal antibody preferably includes the following steps: dilute the above immune antigen to 1 mg / mL, emulsify it with Freund's complete adjuvant at a ratio of 1:1 by volume, and inject it subcutaneously on the neck and back of two New Zealand white rabbits. Multi-point injections (1 mL per mouse) were used for immunization, 4 times at intervals of 2 weeks, and blood was collected to detect the antibody titer by ELISA method; after the antibody titer reached 1:80000, the serum was collected and purified, ELISA and western After blot identification, polyclonal antibodies against ANR1 and ANR2 were obtained. When the antibody is a monoclonal antibody, the present inv...

Embodiment 1

[0048] Design and synthesis of embodiment 1ANR1 and ANR2 protein polypeptide

[0049] (1) According to the ANR1 and ANR2 gene sequences (SEQID No.3~No.4) cloned in Yinghong No.9 and Nankunshan Maoyecha tea plants, ANR1 and ANR2 in different tea tree resources were obtained by Blast search on GenBank Gene.

[0050] ANR1 gene sequence (SEQ ID No.3):

[0051] ATGGAAGCCCAACCGACAGCTCCGAAGGCCGCATGTGTTGTTGGTGGCACCGGCTTCGTGGCGGCGACGCTCATCAAGTTGTTGCTTGAGAAAGGCTATGCGGTCAACACCACTGTCCGAGACCCAGGCAATCAGAAAAAGACCTCTCACCTTCTAGCACTAAAGGGTTCAGGCAACCTAAAAATCTTCCGAGCAGACCTCACCGATGAACAGAGCTTTGACGCCCCTGTAGCGGGTTGTGACCTGGTCTTCCATGTCGCTACACCAGTCAACTTTGCTTCCGAGGATCCAGAGAATGACATGATAAAACCAGCAATTCAAGGAGTAGTCAATGTTCTAAAAGCTTGTGCAAAAGCAGGAACGGTTAAACGTGTCATTTTAACATCATCAGCAGCTGCTGTATCGATCAATAAGCTCAATGGGACCGGCCTGGTCATGGATGAGAGTCACTGGACTGACACCGAGTTTTTGAATTCTGCGAAGCCGCCCACTTGGGGGTACCCTTTATCGAAAACACTAGCTGAGAAAGCTGCTTGGAAGTTTGCCGAAGAAAATAACATTAATCTTATCACTGTCATCCCAACTCTCATGGCCGGTCCGTCACTTACTGCAGATGTCCCTAGCAGTATTGG...

Embodiment 2

[0058] 1. ANR1 and ANR2 protein antigen polypeptide preparation and immunization method

[0059] 1. ANR1 protein antigen polypeptide (NQKKTSHLLALKGS) and ANR2 antigen polypeptide (NFASEDPENDMIKPA) were synthesized by Qiangyao Biotechnology Company.

[0060] 2. Both ANR1 and ANR2 antigen polypeptides are coupled with KLH and BSA to prepare immune antigens and detect antigens

[0061] (1) Using the SMCC kit (purchased from Thermo Fisher Scientific) to couple the ANR1 and ANR2 antigen polypeptides to KLH respectively (the coupling agent is Sulfo-SMCC) to prepare immune antigens. The specific method is: weigh 4 mg of the ANR1 and ANR2 antigen polypeptides Dissolve in 0.4mL of PBS (pH 7.2, the same below), add 4mg of Sulfo-SMCC, incubate at 4°C for 2h, then add 25mg of KLH solution (concentration: 20mg / mL) to ANR1-SMCC and ANR2-SMCC , reacted at 4°C for 2h, and dialyzed in PBS buffer for 24h to obtain ANR1-KLH and ANR2-KLH immune antigens, which were stored at -20°C.

[0062] The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of protein detection, and particularly relates to a tea tree anthocyanin reductase protein antigen polypeptide and an antibody, detection kit and application thereof. The tea tree anthocyanin reductase protein antigen polypeptide is at least one of tea tree anthocyanin reductase 1 antigen polypeptide and anthocyanin reductase 2 protein antigen polypeptide, wherein the amino acid sequence of the tea tree anthocyanin reductase 1 antigen polypeptide is shown as SEQ ID No. 1, and the amino acid sequence of the tea tree anthocyanin reductase 2 antigen polypeptide is shown as SEQ ID No. 2. The invention also provides an immune antigen and detection antigen of the tea tree anthocyanin reductase protein and an antibody for resisting the tea tree anthocyanin reductase protein antigen. The antibody not only can lay a foundation for functional research of the protein, but also has positive reference significance for subsequent research on metabolism offlavonoids and other substances in tea trees.

Description

technical field [0001] The invention belongs to the technical field of protein detection, and in particular relates to a tea tree anthocyanin reductase protein antigen polypeptide, an antibody thereof, a detection kit and application thereof. Background technique [0002] Anthocyanidin reductase 1 (Anthocyanidin reductase 1, ANR1) and anthocyanidin reductase 2 (Anthocyanidin reductase 2, ANR2), ANR1 and ANR2 are one of the structural enzymes in the metabolic pathway of flavonoid biosynthesis. Both ANR1 and ANR2 can catalyze cyanidin into catechin (C) and epicatechin (EC), and delphinidin into gallocatechin (GC) and epigallocatechin (EGC), Thus, both ANR1 and ANR2 have epimerase activity. ANR1 and ANR2 are not only the key enzymes of anthocyanin metabolism in plants, but also play a key regulatory role in the synthesis and accumulation of catechins in plants. However, the content of flavonoids such as anthocyanins and catechins in tea trees will vary due to different growth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C07K19/00C07K16/40C07K16/06C12N5/20G01N33/577G01N33/573
CPCC07K16/06C07K16/40C07K2319/31C12N9/001C12Y103/01077G01N33/573G01N33/577G01N2333/90206
Inventor 陈忠正黄秋灿施婧李斌张媛媛林晓蓉
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More