Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleotide sequence for reducing uricase gene expression and application

A technology of gene expression and uricase, which is applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of constructing high uric acid model mice with RNA interference technology, and achieve the effects of long duration, convenient operation and long survival time

Inactive Publication Date: 2021-01-15
STAIDSON (BEIJING) BIOPHARMACEUTICALS CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] At present, there is no report of using RNA interference technology to construct a high uric acid model mouse. Therefore, a specific RNA interference sequence targeting the uricase gene is found, and the interference sequence is constructed on an adeno-associated virus vector. The virus vector enters the body, thereby inhibiting The expression of uricase, which provides a new idea for the effective construction of a high uric acid model animal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence for reducing uricase gene expression and application
  • Nucleotide sequence for reducing uricase gene expression and application
  • Nucleotide sequence for reducing uricase gene expression and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1 vector construction

[0056] According to the sequence of mouse uricase gene (Uox) (Genebank: NM_009474.5), using https: / / www.sigmaaldrich.com / life-science / functional-genomics-and-rnai / sirna / mission-predesigned-sirna.html The website designs an RNA interference fragment targeting the mouse uricase gene, and the specific sequence is shown in Table 1.

[0057] Table 1

[0058] name Target sequence (SEQ ID NO:5-8) Sense strand (5'-3') (SEQ ID NO:1-4) Antisense strand (5'-3') (SEQ ID NO:9-12) siRNA#1 ATACCACAGCATCAAAGAGGT AUACCACAGCAUCAAAAGAGGU ACCUCUUUGAUGCUGUGGUAU siRNA#2 AAGTGTACTGCAAGTGGCGCT AAGUGUACUGCAAGUGGCGCU AGCGCCACUUGCAGUACACUU siRNA#3 CAGACACCATCAAGAACACTG CAGACACCAUCAAGAACACUG CAGUGUUCUUGAUGGUGUCUG siRNA#4 CAGACACCATCAAGAAGAACACAG CAGACCACCAUCAAGAACACAG CUGUGUUCUUGAUGGUGUCUG

[0059] The above-mentioned RNA interference fragment is designed to form a hairpin structure sequence as show...

Embodiment 2

[0065] Example 2 Virus Packaging and Genome Titer Detection

[0066] In this example, HEK293T cells (purchased from ATCC, number CRL-11268) were used as the production cell line, and the conventional three-plasmid packaging system was used to produce the recombinant AAV virus vector. The experimental methods used are routine methods in this area (referring to XiaoXiao, Juan Li, and Richard Jude Samulski.Production of high-titer recombinantadeno-associated virus vectors in the absence of helperadenovirus.J.Virol.1998,72(3):2224 ).

[0067] Take an appropriate amount of purified AAV sample, prepare a DNase I digestion reaction mixture, incubate at 37°C for 30 minutes, and incubate at 75°C for 10 minutes to inactivate DNase I.

[0068] After the treated AAV purified sample was diluted to an appropriate multiple, a Q-PCR reaction system was configured with reference to the following table (Table 4), and detection was performed according to the following procedure.

[0069] Table...

Embodiment 3

[0077] Example 3 Recombinant viruses containing different interference fragments reduce the efficiency detection of uricase gene expression in mice

[0078] Select 6-8 week old C57 mice and divide them into 5 groups, 4 kinds of administration groups (rAAV-shRNA#1, rAAV-shRNA#2, rAAV-shRNA#3, rAAV-shRNA#4) and PBS blank control group , tail vein injection, each administration group was set as a specific interference group. The injection dose of the four administration groups was 1×10 12 vg / kg, the blank control group was injected with PBS at a dose of 200 μl, and sacrificed 2 weeks after the injection. At the same time, serum and liver tissue were collected for the detection of blood uric acid and Uox protein.

[0079] Firstly, the serum was separated by centrifugation (4,000 rpm, 4°C, 5 minutes), and then the blood uric acid levels in different groups were detected with the Uric Acid Assay Kit (sigma, MAK077). For specific operations, refer to the kit instructions. First pre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of RNA sequences for reducing uricase gene expression, a DNA sequence corresponding to the group of sequences, a modified nucleotide sequence, a double-stranded nucleotide sequence, a delivery vector containing the nucleotide sequences, and a method for constructing a hyperuricemia mouse model by applying the nucleotide sequences or the delivery vector. The invention has the advantages that a group of novel nucleotide sequences for inhibiting uricase gene expression is disclosed, the uric acid level of hyperuricemia mice constructed by using the nucleotide sequences or the delivery vector containing the nucleotide sequences is increased stably, the pathogenesis is similar to that of human beings, and the survival time of the mice is long; and the animal model construction period is relatively short, and the operation is convenient, so that a better animal model is provided for subsequent evaluation of drugs for treating diseases such as hyperuricemia andrelated gout and the like.

Description

technical field [0001] The invention relates to the field of gene therapy, in particular to a group of nucleotide sequences and applications for reducing uricase gene expression. Background technique [0002] Hyperuricemia is a type of disease caused by purine metabolism disorder or decreased uric acid excretion, which leads to excessive serum uric acid level. It refers to men with fasting blood uric acid levels higher than 420 μmol / L twice on different days under normal purine diet. , women are higher than 360μmol / L, which is called hyperuricemia. Hyperuricemia is an important basis for the pathogenesis of gout, renal dysfunction and various cardiovascular diseases. First, it is often closely related to the development of diseases such as hypertension, diabetes, obesity, and atherosclerosis, and is an important disease that threatens human health. Controlling hyperuricemia has a better preventive effect on these diseases. [0003] The current drugs for the treatment of h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/864A01K67/027
CPCC12N15/1137C12N15/86A01K67/0275C12N2310/14C12Y107/03003C12N2750/14143C12N2800/107A01K2207/05A01K2227/105A01K2267/03C12N2310/531
Inventor 牛玉强王超李忠
Owner STAIDSON (BEIJING) BIOPHARMACEUTICALS CO LTD