Method for obtaining fragmented DNA single-stranded pool and application thereof
A fragmentation and single-strand technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of reducing the sensitivity and accuracy of detection methods, failing to display a variety of fragmented cfDNA genetic information, and reducing post-detection methods Sensitivity and accuracy and other issues to achieve the effect of avoiding loss
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Embodiment 1: The method for obtaining single-stranded pool in the present invention and the double-primer PCR method based on Lambda exonuclease degradation method
[0062] Schematic diagram of the principle of the double-primer PCR method based on the Lambda exonuclease degradation method Image 6 ;
[0063] In this example, a single complementary primer F1 of the present invention is designed for the cfDNA sample mutation site, and paired primers R1 and R2 with lengths of 80 nt and 150 nt respectively are designed to form two sets of paired primers F1 and R1, and F1 and R2; see Table 1 for details;
[0064] Table 1
[0065]
[0066] cfDNA sample: EGFRMultiplex cfDNA Reference Standard (the cfDNA contains 1% EGFRL861Q mutation, commercially available);
[0067] Wild type sequence:
[0068] ACAGATTTTGGGCTGGCCAAAC T GCTGGGTGCGGAAGAGAAAGAATACC;
[0069] Mutant sequence:
[0070] ACAGATTTTGGGCTGGCCAAAC A GCTGGGTGCGGAAGAGAAAGAATACC;
[0071] The oligonucleotide...
Embodiment 2
[0092] Embodiment 2: Feasibility verification of the technology of the improved lock probe+Blocker probe of the present invention
[0093] This embodiment selects the sequences in Table 5 for feasibility analysis, but this should not be a limitation of the present invention. According to the principles and schemes provided by the present invention, different probe sequences can be designed for the target through software, which is not possible in the present invention. Exhaustive;
[0094] table 5
[0095]
[0096] Note: All Blocker probes in Table 5 are wild-type probes;
[0097] In Table 5, the italic part of the Padlock probe (lock probe) sequence is the I region sequence, the underlined part is the III region sequence (free energy is -17.49Kcal / mol), and the rest is the II region sequence; wild-type template and mutant The template is a G-T mutation at the 16th base; the italic part in the Blocker 1 sequence is the b region sequence, and the others are the a region se...
Embodiment 3
[0128] Example 3: Verification of the method for detecting cfDNA
[0129] On the basis of Example 1, the EGFRMultiplex cfDNA Reference Standard sample is detected in combination with the improved padlock probe+Blocker probe technology of the present invention. The designed related probes are shown in Table 8 below, and the connection system of different Blocker probes is added. See Table 11-14, and see Table 15 for the RCA reaction system;
[0130] Table 11
[0131]
[0132] In Table 11, the italic part of the Padlock probe (lock probe) sequence is the I region sequence, the underlined part is the III region sequence (free energy is -19.38Kcal / mol), and the rest is the II region sequence; wild-type template and mutant The template is a G-T mutation at the 23rd base; the italic part in the Blocker 1 sequence is the b region sequence, and the others are the a region sequence (free energy is -19.24Kcal / mol); the italic part in the Blocker 2 sequence is the b region sequence, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


