Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for obtaining fragmented DNA single-stranded pool and application thereof

A fragmentation and single-strand technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of reducing the sensitivity and accuracy of detection methods, failing to display a variety of fragmented cfDNA genetic information, and reducing post-detection methods Sensitivity and accuracy and other issues to achieve the effect of avoiding loss

Active Publication Date: 2021-02-26
TIANJIN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The longer ssDNA is easy to form secondary structures, which will reduce the sensitivity and accuracy of later detection methods
[0007] In summary, the single-strand cfDNA obtained by the common PCR method of lambda exonuclease degradation cannot display all the genetic information of the sites to be detected in various fragmented cfDNA, and it is easy to generate by-products with complex secondary structures. Reduce the sensitivity and precision of subsequent detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining fragmented DNA single-stranded pool and application thereof
  • Method for obtaining fragmented DNA single-stranded pool and application thereof
  • Method for obtaining fragmented DNA single-stranded pool and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1: The method for obtaining single-stranded pool in the present invention and the double-primer PCR method based on Lambda exonuclease degradation method

[0062] Schematic diagram of the principle of the double-primer PCR method based on the Lambda exonuclease degradation method Image 6 ;

[0063] In this example, a single complementary primer F1 of the present invention is designed for the cfDNA sample mutation site, and paired primers R1 and R2 with lengths of 80 nt and 150 nt respectively are designed to form two sets of paired primers F1 and R1, and F1 and R2; see Table 1 for details;

[0064] Table 1

[0065]

[0066] cfDNA sample: EGFRMultiplex cfDNA Reference Standard (the cfDNA contains 1% EGFRL861Q mutation, commercially available);

[0067] Wild type sequence:

[0068] ACAGATTTTGGGCTGGCCAAAC T GCTGGGTGCGGAAGAGAAAGAATACC;

[0069] Mutant sequence:

[0070] ACAGATTTTGGGCTGGCCAAAC A GCTGGGTGCGGAAGAGAAAGAATACC;

[0071] The oligonucleotide...

Embodiment 2

[0092] Embodiment 2: Feasibility verification of the technology of the improved lock probe+Blocker probe of the present invention

[0093] This embodiment selects the sequences in Table 5 for feasibility analysis, but this should not be a limitation of the present invention. According to the principles and schemes provided by the present invention, different probe sequences can be designed for the target through software, which is not possible in the present invention. Exhaustive;

[0094] table 5

[0095]

[0096] Note: All Blocker probes in Table 5 are wild-type probes;

[0097] In Table 5, the italic part of the Padlock probe (lock probe) sequence is the I region sequence, the underlined part is the III region sequence (free energy is -17.49Kcal / mol), and the rest is the II region sequence; wild-type template and mutant The template is a G-T mutation at the 16th base; the italic part in the Blocker 1 sequence is the b region sequence, and the others are the a region se...

Embodiment 3

[0128] Example 3: Verification of the method for detecting cfDNA

[0129] On the basis of Example 1, the EGFRMultiplex cfDNA Reference Standard sample is detected in combination with the improved padlock probe+Blocker probe technology of the present invention. The designed related probes are shown in Table 8 below, and the connection system of different Blocker probes is added. See Table 11-14, and see Table 15 for the RCA reaction system;

[0130] Table 11

[0131]

[0132] In Table 11, the italic part of the Padlock probe (lock probe) sequence is the I region sequence, the underlined part is the III region sequence (free energy is -19.38Kcal / mol), and the rest is the II region sequence; wild-type template and mutant The template is a G-T mutation at the 23rd base; the italic part in the Blocker 1 sequence is the b region sequence, and the others are the a region sequence (free energy is -19.24Kcal / mol); the italic part in the Blocker 2 sequence is the b region sequence, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, and discloses a method for obtaining a fragmented DNA single-stranded pool and application thereof. According to the invention, PCR amplification fragmentation DNA is carried out in the presence of ddNTPs by using only one primer close to a to-be-detected site; a DNA single-stranded pool with a relatively short length and a ddNTP at the tailend is generated, so that the length of an amplified fragment is concentrated at 80-120 nt; compared with a method without adding ddNTPs, the method disclosed by the invention has the advantages that: the short single-stranded DNA fragment with the to-be-detected site can be more fully and comprehensively amplified from the fragmented DNA; the length of the generated fragment is relatively short;the length distribution of the generated fragment is relatively narrow; meanwhile, when a Blocker-mediated lock type probe technology and other hybridization probes are subsequently applied to detection of the fragmented DNA, the detection is more accurate and sensitive; and thus, the method can be applied to related detection of the fragmented DNA.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to a method for obtaining fragmented DNA single-strand pools and its application. Background technique [0002] Cancer is a common malignant tumor in clinical practice. This disease progresses rapidly and has a high mortality rate. It has caused huge harm to the patient's body, mind and economy. It is also a public health issue that everyone pays more attention to. In recent decades, the diagnosis of cancer has been a hot topic of research. In 2013, "Nature" published a paper confirming that the vast majority of human cancers are caused by 21 major gene mutations. So far, Genetic testing has become an important means of cancer treatment and prevention. Through genetic testing, we can find out these mutated genes in the human body, and then choose chemotherapy drugs or molecular targeted therapy drugs "different from person to person" according to the results of genetic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806C12Q1/6858
CPCC12Q1/6806C12Q1/6858C12Q2525/113C12Q2531/107C12Q2521/319C12Q2531/125C12Q2537/163
Inventor 齐浩郜艳敏
Owner TIANJIN UNIV