Yeast genome editing method based on CRISPR/Cas9

A genome editing and genome technology, applied in microorganism-based methods, other methods of inserting foreign genetic materials, genetic engineering, etc., can solve the problems of low PCR product concentration, unfavorable operation, etc., to ensure editing efficiency, shorten experimental time and Cost, efficient and convenient editing effect

Pending Publication Date: 2021-03-09
ZHEJIANG UNIV OF TECH
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, usually the concentration of the PCR product of the vector backbone is low, which is not conducive to subsequent operations, especially when the gRNA and Cas9 are in the same plasmid and the vector backbone exceeds 10,000 bp

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast genome editing method based on CRISPR/Cas9
  • Yeast genome editing method based on CRISPR/Cas9
  • Yeast genome editing method based on CRISPR/Cas9

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1, the construction of expressing Cas9 bacterial strain YD005

[0043] A major player in glucose repression is a zinc finger protein, MIG1, that binds to the promoters of many genes and represses their transcription by repressing genes encoding transcriptional activators. The inhibitory effect of MIG1 can be direct or indirect. Galactose metabolism is controlled by an enzyme encoded by the GAL gene, however, in the presence of glucose, the GAL gene is repressed by a repressor gene. Most of the GAL genes are directly repressed, while the GAL4 gene is indirectly repressed through MIG1 (Jakub et al. Combinatorial control of gene expression by the three yeast repressors Mig1, Mig2 and Mig3[J]. Bmc Genomics, 2008.). In order to improve the activity of the GAL-type promoter, we knocked out MIG1 and at the same time realized the expression of Cas9 protein, which provided the basis for subsequent gene editing.

[0044] 1. Construction and transformation of Cas9 pro...

Embodiment 2

[0053] Example 2 Preparation of GRE3, PHO13 and ASC1 gRNA expression cassettes

[0054] 1. Construction of gRNA expression cassette containing target site GRE3

[0055] Utilize chopchop website, design target sequence according to target site GRE3 gene (Saccharomyces Genome DatabaseYHR104W), described target sequence is as follows:

[0056] GRE3 target sequence: ACCAATCATAGATACGTACC (SEQ ID NO. 10).

[0057] Using Addgene's commercialized plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t (abbreviated as p426) as a template, primers P11 / P12 were used to amplify the upstream homology arm fragment of the gRNA expression cassette of the target site GRE3 ( SEQ ID NO.1); Using primers P13 / P14, PCR amplification obtained the downstream homology arm fragment (SEQ ID NO.5) of the gRNA expression cassette of the target site GRE3. The DNA splicing method is as described in Example 1. The upstream homology arm fragment, SNR52p promoter fragment (SEQ ID NO.2), target sequence (SEQ ID NO.10), gRNA Sc...

Embodiment 3

[0069]Embodiment 3, transformation of genes related to xylose metabolic pathway

[0070] The gRNA expression cassette of GRE3, the gRNA expression cassette of PHO13, and the gRNA expression cassette of ASC1 constructed in Example 2, together with the p426-SNR52p-gRNA.CAN1.Y-SUP4t vector, XKS1 fragment, XLYA3 fragment, RPE1 fragment, and TAL1 fragment Yeast is transformed to knock out GRE3, PHO13, and ASC1 in the yeast genome, and at the same time introduce xylose metabolism pathways (XKS1 fragment, XLYA3 fragment, RPE1 fragment, TAL1 fragment). The CAN1 gene encodes arginine permease on the plasma membrane, and the p426-SNR52p-gRNA.CAN1.Y-SUP4t vector targets the CAN1 gene, because there is also a CAN1 homologous gene ALP1 on the genome, so even p426-SNR52p -gRNA.CAN1.Y-SUP4t vector edits CAN1 through non-homologous repair, and it will not affect the growth of yeast, which is also proved by experiments (such as image 3 shown). The content of the invention described in this ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a yeast genome editing method based on CRISPR / Cas9. The method comprises the following steps of: designing a target sequence according to target sites on a saccharomyces cerevisiae genome, constructing a gRNA expression cassette by using the target sequence, and then, together transforming saccharomyces cerevisiae cells by using the gRNA expression cassette, a starting vector and donor DNA fragments, so that editing on multiple genome sites of saccharomyces cerevisiae at the same time is realized, wherein homologous arms with the same sequence as the starting vector are arranged on two sides of the gRNA expression cassette; two ends of the donor DNA fragment are provided with homologous arms which are the same as upstream and downstream sequences of a saccharomycescerevisiae genome target site; and Cas9 protein is expressed in the saccharomyces cerevisiae cells. According to the method, gRNA plasmid construction does not need to be carried out in escherichia coli or by utilizing technologies, such as Golden Gate; a gRNA vector skeleton does not need to be amplified; therefore, the experiment time is shortened; the experiment cost is reduced; and multiple genome sites can be efficiently edited at the same time.

Description

[0001] (1) Technical field [0002] The invention relates to a method for genome editing of Saccharomyces cerevisiae. The editing method utilizes overlap extension PCR technology to construct a 20bp target sequence on a DNA fragment containing a gRNA expression cassette, and then simultaneously transforms the fragment with another complete gRNA starting vector Yeast, so that they undergo homologous recombination in yeast, so that the gRNA expression cassette of the target target is stably present on the plasmid through homologous recombination. This method does not require the construction of gRNA vectors in Escherichia coli or using technologies such as Golden Gate, nor does it need to amplify the gRNA vector backbone, which shortens the experimental time and cost, and can efficiently edit multiple genomic sites at the same time. [0003] (2) Background technology [0004] The CRISPR-Cas system is an adaptive immune defense mechanism formed by bacteria during the long-term evo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90C12N15/53C12N15/55C12N15/60C12N15/61C12N15/31C12N1/19C12R1/865
CPCC12N15/113C12N15/905C12N9/0006C12N9/16C12N9/90C12N9/92C12N9/88C07K14/395C12Y101/01021C12Y207/01017C12Y503/01005C12N2310/20
Inventor孙杰尹东魏春袁围郑建永汪钊
OwnerZHEJIANG UNIV OF TECH