Wheat stripe rust resistance gene yrZ15-1370 as well as molecular marker and application thereof
A molecular marker and stripe rust technology, applied in the field of molecular biology, can solve the problem that the genetic diversity of wild species has not been effectively developed and utilized, and achieve a new type of stripe rust resistance source, high utilization value, accurate and efficient detection. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Acquisition of stripe rust resistance gene yrZ15-1370 and its molecular marker KASP-Z1370-1
[0039] In the present invention, the wild einkorn wheat introgression line Z15-1370 with exogenous disease resistance gene source is used as the female parent, and the wheat variety 'Mingxian 169' is used as the male parent to cross hybridization to obtain the hybrid F 1 , F 1 F 2 , F 2 F 2:3 Family, the population size is 410 lines, in order to construct the genetic mapping population. to F 2 , F 2:3 The stripe rust phenotypes of the family groups were identified, and the parents 'Z15-1370', 'Mingxian 169' and F 2:3 30 high-resistance homozygous plants and 30 high-sensitivity homozygous single-plant RNAs in the family group. The present invention uses the mixed-pool transcriptome sequencing BSR-Seq method to locate the wheat stripe rust resistance gene yrZ15-1370.
[0040] According to the transcriptome data, combined with the phenotypes of the parents and mix...
Embodiment 2
[0055] Example 2 Molecular marker KASP-1370-1 in verification population 'Z15-1370' × wheat variety 'Avocet S'F 2 application in
[0056] 1) Using F 2 To verify the population plants, there are 68 individual plants in the offspring lines.
[0057] 2) KASP-1370-1 marker detection was carried out on the obtained 68 individual plants. The specific method was: extract the DNA of 68 individual plants; use it as a template, and use the specific primer pair of molecular marker KASP-1370-1 as Primers carry out PCR amplification and carry out fluorescence reading value, and described primer is:
[0058] Primers on the FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT AGGAGAAAGATGAGCCCAAAA-3';
[0059] Primers on the HEX tag: (the wavy part is the HEX tag sequence) 5'- GAAGGTCGGAGTCAACGGATT AGGAGAAAGATGAGCCCAAAG-3';
[0060] Universal downstream primer: 5'-CCAAGATCGTCCTCCTACTC-3'.
[0061] The amplification system of the above PCR amplification is...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap