Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wheat stripe rust resistance gene yrZ15-1370 as well as molecular marker and application thereof

A molecular marker and stripe rust technology, applied in the field of molecular biology, can solve the problem that the genetic diversity of wild species has not been effectively developed and utilized, and achieve a new type of stripe rust resistance source, high utilization value, accurate and efficient detection. Effect

Active Publication Date: 2021-03-12
SICHUAN AGRI UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the great potential of wild species for improving wheat has been recognized long ago, the genetic diversity of wild species has not yet been effectively exploited and utilized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat stripe rust resistance gene yrZ15-1370 as well as molecular marker and application thereof
  • Wheat stripe rust resistance gene yrZ15-1370 as well as molecular marker and application thereof
  • Wheat stripe rust resistance gene yrZ15-1370 as well as molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Acquisition of stripe rust resistance gene yrZ15-1370 and its molecular marker KASP-Z1370-1

[0039] In the present invention, the wild einkorn wheat introgression line Z15-1370 with exogenous disease resistance gene source is used as the female parent, and the wheat variety 'Mingxian 169' is used as the male parent to cross hybridization to obtain the hybrid F 1 , F 1 F 2 , F 2 F 2:3 Family, the population size is 410 lines, in order to construct the genetic mapping population. to F 2 , F 2:3 The stripe rust phenotypes of the family groups were identified, and the parents 'Z15-1370', 'Mingxian 169' and F 2:3 30 high-resistance homozygous plants and 30 high-sensitivity homozygous single-plant RNAs in the family group. The present invention uses the mixed-pool transcriptome sequencing BSR-Seq method to locate the wheat stripe rust resistance gene yrZ15-1370.

[0040] According to the transcriptome data, combined with the phenotypes of the parents and mix...

Embodiment 2

[0055] Example 2 Molecular marker KASP-1370-1 in verification population 'Z15-1370' × wheat variety 'Avocet S'F 2 application in

[0056] 1) Using F 2 To verify the population plants, there are 68 individual plants in the offspring lines.

[0057] 2) KASP-1370-1 marker detection was carried out on the obtained 68 individual plants. The specific method was: extract the DNA of 68 individual plants; use it as a template, and use the specific primer pair of molecular marker KASP-1370-1 as Primers carry out PCR amplification and carry out fluorescence reading value, and described primer is:

[0058] Primers on the FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT AGGAGAAAGATGAGCCCAAAA-3';

[0059] Primers on the HEX tag: (the wavy part is the HEX tag sequence) 5'- GAAGGTCGGAGTCAACGGATT AGGAGAAAGATGAGCCCAAAG-3';

[0060] Universal downstream primer: 5'-CCAAGATCGTCCTCCTACTC-3'.

[0061] The amplification system of the above PCR amplification is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat stripe rust resistance gene yrZ15-1370 as well as a molecular marker and application thereof. The wheat stripe rust resistance gene yrZ15-1370 is located on a long armof a 6A chromosome of wheat, and the physical position of the wheat stripe rust resistance gene yrZ15-1370 in a RefSeqv1.0 genome version is 601.47 Mb and 603.30 Mb. The SNP site of the molecular marker is located in the interval of yrZ15-1370, the polymorphism is A / G, and the molecular marker can accurately track the wheat stripe rust resistance gene yrZ15-1370. The invention further discloses aprimer group for identifying the wheat stripe rust resistance gene yrZ15-1370, the primer group provided by the invention can be used for rapidly screening out a wheat variety or strain with the wheatstripe rust resistance gene yrZ15-1370 for breeding, and the breeding process of a wheat disease-resistant variety can be greatly accelerated.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a wheat stripe rust resistance gene yrZ15-1370 and its molecular marker and application. Background technique [0002] Wheat stripe rust is a worldwide important disease caused by wheat stripe rust. There have been many stripe rust pandemics in the history of our country, and severe years can lead to a reduction of more than 40% of wheat production, or even no harvest. Due to the frequent variation of the physiological races of stripe rust, the emergence of new toxic physiological races often leads to the rapid "loss" of resistance of wheat varieties, triggering the epidemic of stripe rust and threatening the safe production of wheat. The continuous and effective control of wheat stripe rust is a long-term international problem. Therefore, discovering and utilizing new stripe rust resistance genes, increasing the diversity of stripe rust resistance genes, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C12Q1/6895C12Q1/6858
CPCC07K14/415C12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 刘登才张明虎张连全柳欣黄林郝明梁东玉袁中伟甯顺腙姜博陈雪姣
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com