Molecular marker closely linked with vigor character of sweet corn seeds and application

A molecular marker, sweet corn technology, applied in the field of molecular biology, can solve the problems of negative correlation of sugar content, hindered starch synthesis, low emergence rate of sweet corn, etc., to shorten the breeding process and improve the vigor of seeds

Active Publication Date: 2021-03-26
CROP RES INST GUANGDONG ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The formation of sweet corn is closely related to the starch synthesis and metabolism of the grain. During the synthesis of glucose and starch in the grain, due to the mutation of one or several genes, the starch synthesis may be blocked, and glucose and other carbohydrates may accumulate. However, Seed emergence rate is positively correlated with seed starch content, and negatively correlated with sugar content, resulting in lower emergence rate and weak seedling vigor of sweet corn than ordinary corn. This phenomenon is more prominent in super sweet corn. Therefore, improving sweet corn Seed vigor is the most urgent issue that breeders are most concerned about. However, there are few studies on the genetic basis of sweet corn seed vigor, and there are no reports on the cloning of genes related to seed vigor.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker closely linked with vigor character of sweet corn seeds and application
  • Molecular marker closely linked with vigor character of sweet corn seeds and application
  • Molecular marker closely linked with vigor character of sweet corn seeds and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Experimental materials: 295 temperate tropical sweet corn inbred lines from China, the United States, Thailand and other places were collected to form an association group for genome-wide association analysis (provided by the Crop Research Institute of Guangdong Academy of Agricultural Sciences). genetic diversity.

[0037] The sample sources are shown in Table 1.

[0038] Table 1

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048] 2. Field experiment design: planted in Dafeng Base, Guangzhou in 2017, using a completely randomized block design, setting up two replicates, with a plant spacing of 0.25 meters, and about 10 plants in each row. Field management measures such as fertilization, watering, and weeding are all in accordance with local Managed at normal levels, harvested after physiological maturity, and dried naturally.

[0049] 3. Phenotypic identification of related populations: After drying, s...

Embodiment 2

[0056] Example 2, SNP site screening and target gene positioning

[0057] Genome-wide association analysis: A total of 9.8 million high-quality SNP sites were obtained through resequencing analysis of the associated population, combined with 9.8 million SNPs, population structure, kinship, and seed vigor-related traits of the associated population, and used in TASSEL Genome-wide association analysis was performed using the MLM model based on the genome-wide significance level (P≤1×10-6), and a candidate gene (Zm00001d027504) was found on chromosome 1 (its nucleotide sequence was obtained from the website of gramene, position In 1:6907596-6912220), the gene encodes a nucleoside triphosphate, and there are three non-synonymous mutation SNP sites on the sixth exon of the gene, one of which is a SNP site (named as marker S1_6908324) It is significantly correlated with seed germination potential (p=5.19216E-08), which can explain 11.9% of the phenotypic variation. The other two SNP...

Embodiment 3

[0059] Example 3, Molecular marker primer design of Zm00001d027504 gene

[0060] For markers S1_6908324, marker S1_6908332, marker S1_6908437 and marker S1_6907721, design allele-specific KASP primers for amplification and detection, select 19-21 bases on the left side of the SNP position as marker F1 and F2 primers, and take the SNP One base at the mutation site is the F1 primer, the other base is the F2 primer, and two adapters are respectively connected, and the 19-22 bases at the 40-100bp position on the right side of the SNP are selected as R primers, so that the fluorescent detection platform To achieve the purpose of detecting different SNP genotypes.

[0061] The primer sequences labeled S1_6908324 are as follows:

[0062] Ph1F1: gaaggtgaccaagttcatgctTTGTGCCTCCGCCCGTACATGCC (SEQ ID NO: 1)

[0063] Ph1F2: gaaggtcggagtcaacggattTTGTGCCTCCGCCCGTACATGCT (SEQ ID NO: 2)

[0064] Ph1R: CATGAAGTCCTTCGTCAGAGC (SEQ ID NO: 3)

[0065] The primer sequence of marker S1_6908332 i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Bud lengthaaaaaaaaaa
Login to view more

Abstract

The invention relates to the field of molecular biology, and particularly discloses a molecular marker closely linked with the vigor character of sweet corn seeds and application. A sixth exon of a Zm00001d027504 gene in a corn chromosome 1 contains three SNP markers, namely a marker S1_6908324, a marker S1_6908332 and a marker S1_6908437, a 3' UTR region contains a fourth SNP marker-marker S1_6907721, the physical positions of the marker S1_6908324, the marker S1_6908332 and the marker S1_6908437 are 6908324, 6908332 and 6908437 respectively, and the physical position of the marker S1_6907721is 6907721. The four molecular markers are found, and a new way is provided for improving vigor breeding of corn seeds.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a molecular marker closely linked with the vigor traits of sweet corn seeds and its application. Background technique [0002] Sweet corn is a subspecies of the genus Maize, which originated in the American continent. It is an economical crop that integrates grain, fruit, vegetables, and feed. Humans have planted and eaten sweet corn for more than 100 years. Fresh ears of sweet corn can be directly marketed or processed. When milk is ripe, the grains are rich in protein, water-soluble polysaccharides, various free amino acids and vitamins, and have high nutritional value, processing value and economic value. With the improvement of people's living standards, sweet corn has also ushered in more consumers. The United States is the first country in the world to carry out sweet corn breeding research. As early as 1828, the American Sorbe published the first paper on sweet corn resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/172C12Q2531/113C12Q2563/107
Inventor 肖颖妮胡建广李高科于永涛李坤
Owner CROP RES INST GUANGDONG ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap