A screening method for nucleic acid aptamer specifically binding to sarafloxacin hydrochloride

A technology of salafloxacin hydrochloride and nucleic acid aptamer, which is applied in the field of chemical analysis, can solve the problems of food safety consequences and antibiotic residues, and achieves the effects of short screening period, high affinity and convenient synthesis

Active Publication Date: 2022-04-19
BEIJING UNIV OF CHEM TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the toxicity of sarafloxacin, the extensive use of sarafloxacin in poultry and fish will lead to antibiotic residues, which will bring extremely serious consequences to people's food safety
Extensive use of sarafloxacin in poultry and fish will lead to antibiotic residues, which will bring extremely serious consequences to people's food safety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A screening method for nucleic acid aptamer specifically binding to sarafloxacin hydrochloride
  • A screening method for nucleic acid aptamer specifically binding to sarafloxacin hydrochloride
  • A screening method for nucleic acid aptamer specifically binding to sarafloxacin hydrochloride

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Embodiment 1: Synthesis of the ssDNA library and primers shown below:

[0078] Raw random ssDNA library:

[0079] 5'-AAGGAGCAGCGTGGAGGATA-N40-TTAGGGTGTGTCGTCGTGGT-3';

[0080] Upstream primer: 5'-AAGGAGCAGCGTGGAGGATA-3'

[0081] Downstream primer 1: 5'-ACCACGACGACACACCCTAA-3'

[0082] Downstream primer 2: 5'-bio-ACCACGACGACACACCCTAA-3'

Embodiment 2

[0083] Embodiment 2: SELEX technology screening specific nucleic acid aptamer

[0084] 2.1 The solution required for the experimental process

[0085] (1) 100mL selection buffer configuration method: 0.037g KCl, 0.011g CaCl 2 , 0.5844g NaCl, 0.019g MgCl 2 , 0.24g Tris, 20μL Tween 20, adjust the pH to 7.6, make up to 100mL with deionized water;

[0086] (2) 100mL washing buffer configuration method: 21g urea, 0.48g Tris, 0.37g EDTA. Na 2 , 20μL Tween 20, adjust the pH to 8.0, make up to 100mL with deionized water;

[0087] (3) 100mL Binding and Washing (BW) Buffer configuration method: 0.12g Tris, 0.037g EDTA. Na 2 , 11.68g NaCl, adjust the pH to 7.4, make up to 100mL with deionized water;

[0088] (4) 100mL amino magnetic bead coupling buffer configuration method: 1.95g 2-morpholineethanesulfonic acid, adjust the pH to 4.0, make up to 100mL with deionized water;

[0089] (5) 100mL amino magnetic bead blocking buffer configuration method: 2.4g Tris, adjust the pH to 8.0...

Embodiment 3

[0124] Example 3. High-throughput sequencing and sequence analysis

[0125] After the final round of screening products were amplified by PCR, they were subjected to agarose gel electrophoresis, and the 80bp bands were recovered by gel cutting, and then sent to the company for high-throughput sequencing. The sequence with the most occurrences in the high-throughput sequencing results is sent to the company for synthesis, and then the Kd value is tested, and the secondary structure of the sequence is predicted by software. The sequencing results exclude the formation of primer dimers and sequences containing the complementary strands of the upstream primer and the downstream primer 1. The two sequences with the smallest Kd and the highest affinity with the target molecule are as follows:

[0126] F1: AAGGAGCAGCGTGGAGGATACTCCGTGCGATCGCCGGGGACCGAAGAATCGTTCACATCGTTAGGGTGTGTCGTCGTGGT

[0127] B1: AAGGAGCAGCGTGGAGGATACCATCCACCTAGCATCCATAGGCGAACACTTTCTTGGGGCTTAGGGTGTGTCGTCGTGGT

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A screening method for a nucleic acid aptamer specifically binding to sarafloxacin hydrochloride relates to the technical field of chemical analysis. The invention provides a nucleic acid aptamer that has higher affinity and specificity than protein antibodies, has no immunogenicity, can be chemically synthesized, has small molecular weight and stable properties and can be used for the detection of sarafloxacin hydrochloride. The invention adopts SELEX technology, takes sarafloxacin hydrochloride as a target, and screens out the nucleic acid aptamer specifically binding to sarafloxacin hydrochloride.

Description

technical field [0001] The invention relates to the technical field of chemical analysis, in particular to a screening method for nucleic acid aptamers specifically binding to sarafloxacin hydrochloride. Background technique [0002] Nucleic acid aptamers (also known as aptamers, aptamers) are artificially synthesized ssDNAs or ssDNAs that can specifically bind to target molecules and are screened by the systematic evolution of ligands by exponential enrichment (SELEX) technology. RNA fragments. Aptamers have the advantages of a wide range of target molecules, strong affinity, and easy modification, and are widely used in molecular chemistry, food safety, clinical diagnosis, and treatment. [0003] SELEX is a new technology that uses the principle of combinatorial chemistry to construct an artificially synthesized random oligonucleotide library in vitro, and screen the target nucleic acid aptamer through the specific combination of the sequence in the library and the target...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/10C12N15/115
Inventor李灏丁于敬高子涵
OwnerBEIJING UNIV OF CHEM TECH