Method for improving methyl alcohol biological tolerance and biotransformation efficiency of bacterial strain
A biotransformation, tolerance technology that can address issues such as toxicity in microbe-based methods, methods using microbes, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Embodiment 1 introduces cgl2365 gene missense mutation in Corynebacterium glutamicum MX-11
[0063] Strain C.glutamicum MX-11 was obtained from literature (Tuyishima, P., Wang, Y., Fan, L., Zhang, Q., Li, Q., Zheng, P., Sun, J., Ma, Y., 2018. Engineering Corynebacterium glutamicum formethanol-dependent growth and glutamate production. Metab. Eng. 49, 220-231).
[0064] (1) Construction of pK18mobsacB-tet-cgl2365 C542G plasmid
[0065] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.
[0066] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2365-F1 (TATGACATGATTACGAATTCCAGCTGGGGCAGCGTTGAG; SEQ ID NO: 1) and cgl2365-R1 (CATCCCACCGTGGGCAAGCAGACA; SEQ ID NO: 2) as primers to amplify The upper half fragment of cgl2365, while introducing a mutation from C to G at the 542nd base of cgl2365.
[0067] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide c...
Embodiment 2
[0076] Embodiment 2 introduces cgl2857 gene synonymous mutation in Corynebacterium glutamicum MX-11
[0077] (1) Construction of pK18mobsacB-tet-cgl2857 G183A plasmid
[0078] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.
[0079] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2857-F1 (TATGACATGATTACGAATTCTGCCGAGCGTTTTCATCCAACTG; SEQ ID NO: 7) and cgl2857-R1 (CTTCGGAATCGTCCGCGCCTGACCAGTCAC; SEQ ID NO: 8) as primers to amplify The upper half fragment of cgl2857, while introducing a mutation from base G to A at the 183rd base of cgl2857.
[0080] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2857-F2 (GCGCGGACGATTCCGAAGGATTTGGATCT; SEQ ID NO: 9) and cgl2857-R2 (CGACGGCCAGTGCCAAGCTTCGGCCAAAAACTTGGAAGGCC; SEQ ID NO: 10) as primers to amplify The lower half fragment of cgl2857, while introducing a mutation from base 183 of cgl2857 from G to A. ...
Embodiment 3
[0089] Embodiment 3 methanol biotransformation
[0090] (1) culture medium
[0091] In glucose-free CGXII medium, methanol and xylose were added as carbon sources, and 1 mM isopropylthiogalactopyranoside (IPTG), 5 mg / L chloramphenicol and 25 mg / L kanamycin were additionally added. CGXII medium formula refers to literature (Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. Bacteriol. 175, 5595-5603).
[0092] (2) Culture conditions
[0093] C. glutamicum strain MX-11, MX-11-cgl2365 C542G , MX-11-cgl2857 G183A They were respectively inoculated in shake flasks containing the above-mentioned medium, and the initial OD600nm was about 0.5 (the initial dry cell weight was about 0.153gCDW / L). The shaker flask was cultured in a shaker at a temperature of 30°C and a rotation speed of 220rpm. The size of the shaker flask was 250mL, and the liquid volume was 50mL. The shaker flask was sea...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap