Modified AOX1 promoter variants

Abstract

Pichia pastoris alcohol oxidase 1 (AOX1) promoter variants are characterized by comprising at least one of the specified modifications on wild-type Pichia pastoris AOX1 promoter given by SEQUENCE No 1; the promoter variants include a mutation selecting from the group consisting of: a) integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the ''TTCCGTTCGTCCGA'' gene sequence or other gene sequences that show at least 80% similarity with this sequence, at any positon within nucleotides 94 to 110 (-847 to -831), 141 to 160 (-800 to -781), 312 to 330 (-629 to -611), 355 to 380 (-586 to -561), 501 to 521 (-440 to -420); 640 to 658 (-301 to -283), 674 to 693 (-267 to -248), and 1 to 840 (-940 to -100); b) integration of Aca1 or Aca2 TFBS particularly integration of the "GCCTATTGTAGACGTCAACCC" nucleotide sequence or other gene sequences showing at least 80% similarity with this sequence at any position between the nucleotides 1 to 840 (-940 to -100); c) mutations specified with SEQUENCE No. 2 within nucleotides 94 to 693 (-847 to -248) and combinations thereof; and AOX1 promoter variants further characterized by their enhanced strenght and induction potential when compared with the wild-type AOX1 promoter.

Description

technical field [0001] The present invention relates to an original alcohol oxidase 1 (AOX1) gene promoter variant that has been enhanced or has a redesigned regulatory mechanism that, by virtue of promoter engineering, uses ethanol as the sole carbon and energy source. Background technique [0002] The productivity of a production process is an important criterion in industrial biotechnology applications. The ability of the host microorganism to produce the desired recombinant protein depends on the promoter structure. A promoter gene is a DNA nucleotide sequence within a promoter structure that initiates and continues the synthesis of a recombinant protein and is an upstream DNA element necessary for protein expression. The quantity, quality, functional location of transcription factor binding sites available on a promoter gene and the transcription factors that bind to these locations and their interactions are fundamental components of a promoter structure. The strengt...

AI Technical Summary

Problems solved by technology

However, methanol (a toxic alcohol) was used to induce P AOX1 Can cause risks in bioprocess operations and the possibility of methanol residues in recombinant proteins produced in the food and pharmaceutical industries limits the use of this promoter

As the cost of purification of recombinant protein products to be used in the food industry has been increasing, the common use of crude enzymes in the food industry with poor purity levels has limited the use of methanol

Images