Unlock instant, AI-driven research and patent intelligence for your innovation.

Modified AOX1 promoter variants

A promoter and variant technology, applied in recombinant DNA technology, using vectors to introduce foreign genetic material, oxidoreductase, etc., can solve the problems of restricting the use of promoters, increasing purification costs, and low purity levels

Pending Publication Date: 2021-04-27
中东科技大学
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, methanol (a toxic alcohol) was used to induce P AOX1 Can cause risks in bioprocess operations and the possibility of methanol residues in recombinant proteins produced in the food and pharmaceutical industries limits the use of this promoter
As the cost of purification of recombinant protein products to be used in the food industry has been increasing, the common use of crude enzymes in the food industry with poor purity levels has limited the use of methanol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified AOX1 promoter variants
  • Modified AOX1 promoter variants
  • Modified AOX1 promoter variants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Materials and Methods

Embodiment 11

[0041] AOX1 promoter variants were designed and cloned together with the reporter gene eGFP gene

[0042] Using a two-step overlap extension polymerase chain reaction (OE-PCR) method to construct AOX1 promoter variants, P AOX1-mod (P mAOX1 ), P AOX1-Cat2 (P AOX1 / Cat8-L2 ), P AOX1-Cat3 (P AOX1 / Cat8-L3 ) and P AOX1-Aca (P AOX1 / Aca2 ) promoter variants.

[0043]

[0044] Table 1: Nucleotide sequences of primers designed for integration of Adrl, Cat8 and Aca2 TFBS into the designed promoter variants and cocloning of these promoter variants with eGFP.

[0045] Gene expression levels under AOX1 promoter variants were determined using the enhanced green fluorescent protein (eGFP) gene as a reporter gene. Using the primers given in the table above, the eGFP gene and the AOX1 promoter variant gene were amplified by the OE-PCR method. Any nucleotide additions between the promoter and eGFP gene sequence were prevented. The amplified promoter variants and eGFP gene fragments ...

Embodiment 12

[0048] Transformation of Pichia pastoris with recombinant vectors harboring promoter variants and assessment of expression ability of the promoter variants

[0049] Linearize the recombinant vector containing the AOX1 promoter variant and the eGFP reporter gene using the BglII restriction enzyme according to the manufacturer's recommendations, and transfect the linearized gene fragment into competent Pichia Pasteur prepared by the lithium chloride method Yeast X33 cells (Invitrogen, 2000). After regeneration, the transformants were inoculated on selective YPD agar medium containing ZeocinTM. After transformation, putative clones with expression cassettes containing the promoter variant gene and eGFP reporter gene were verified by colony PCR, and at least 10 individuals were selected from each strain for evaluation of the production capacity of the promoter variant.

[0050] The expression cassette comprises at least one AOX1 promoter variant and at least nucleic acid molecule...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Pichia pastoris alcohol oxidase 1 (AOX1) promoter variants are characterized by comprising at least one of the specified modifications on wild-type Pichia pastoris AOX1 promoter given by SEQUENCE No 1; the promoter variants include a mutation selecting from the group consisting of: a) integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the ''TTCCGTTCGTCCGA'' gene sequence or other gene sequences that show at least 80% similarity with this sequence, at any positon within nucleotides 94 to 110 (-847 to -831), 141 to 160 (-800 to -781), 312 to 330 (-629 to -611), 355 to 380 (-586 to -561), 501 to 521 (-440 to -420); 640 to 658 (-301 to -283), 674 to 693 (-267 to -248), and 1 to 840 (-940 to -100); b) integration of Aca1 or Aca2 TFBS particularly integration of the "GCCTATTGTAGACGTCAACCC" nucleotide sequence or other gene sequences showing at least 80% similarity with this sequence at any position between the nucleotides 1 to 840 (-940 to -100); c) mutations specified with SEQUENCE No. 2 within nucleotides 94 to 693 (-847 to -248) and combinations thereof; and AOX1 promoter variants further characterized by their enhanced strenght and induction potential when compared with the wild-type AOX1 promoter.

Description

technical field [0001] The present invention relates to an original alcohol oxidase 1 (AOX1) gene promoter variant that has been enhanced or has a redesigned regulatory mechanism that, by virtue of promoter engineering, uses ethanol as the sole carbon and energy source. Background technique [0002] The productivity of a production process is an important criterion in industrial biotechnology applications. The ability of the host microorganism to produce the desired recombinant protein depends on the promoter structure. A promoter gene is a DNA nucleotide sequence within a promoter structure that initiates and continues the synthesis of a recombinant protein and is an upstream DNA element necessary for protein expression. The quantity, quality, functional location of transcription factor binding sites available on a promoter gene and the transcription factors that bind to these locations and their interactions are fundamental components of a promoter structure. The strengt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N15/79
CPCC12N15/815C12N9/0006C12P21/02
Inventor P·卡里克B·贡杜兹·埃贡
Owner 中东科技大学