Check patentability & draft patents in minutes with Patsnap Eureka AI!

Establishment and application of coilia ectenes gonad somatic cell line

A technology of somatic cells and scorpionfish, applied in the biological field, can solve the problems of complex cell components and restricting the mechanism of fish spermatogenesis, etc.

Pending Publication Date: 2021-05-28
SHANGHAI OCEAN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the mixed culture of medaka spermatogonial stem cells and rainbow trout gonad cells can induce medaka spermatogenesis stem cells in vitro spermatogenesis, but due to the complex composition of the cells after mixing, the correlation of fish spermatogenesis mechanism is limited to a certain extent. Research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishment and application of coilia ectenes gonad somatic cell line
  • Establishment and application of coilia ectenes gonad somatic cell line
  • Establishment and application of coilia ectenes gonad somatic cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 Cultus sex gland cell culture

[0039] 1. Isolation and Digestion of Gonad Cells from Anchovy

[0040] Take the anchovy from the Yangtze River, soak the fish body in PBS containing 0.5% bleaching powder for 1 min, wash with PBS containing 1% double antibody, pH=7.4 for 3 times, and then dissect. Cut the belly of the fish with scissors, carefully clip out the gonads with tweezers, place them in a petri dish containing 1% double-antibody PBS, carefully peel off the fat tissue on the surface of the gonads with tweezers, wash 3 times with PBS containing 1% double-antibody, and transfer the gonads Transfer to a 1.5mL EP tube containing 500μL of trypsin, cut the tissue properly with scissors, and place it on ice for digestion. After 1 h, 1 mL of medium was added to stop the digestion, and the tissue pieces were gently blown away with a pipette gun, and the cell suspension was transferred to a 24-well plate covered with 0.1% gelatin, and cultured at 28°C.

[004...

Embodiment 2

[0044] The identification of embodiment 2 anchovy sex gland cells

[0045] 1. RT-PCR identification of cultured anchovy sex gland cell types

[0046] In order to identify the type of gonad cells of the cultured Anchovy anchovy, the RNA of the cells was extracted and reversed to cDNA for RT-PCR detection.

[0047] Primer Premier 6 was used to design the primers of sox9, fshr and clu for the sex gland marker genes of Anchovy anchovy and the primers of vasa, dazl and piwi for the germ cell marker genes (see Table 1 for the sequence information of the primers), extract the cellular RNA and convert it into cDNA, and use RT -PCR identification of the gonad cell types of the anchovy.

[0048] Table 1 RT-PCR primer sequence information

[0049] gene name Primer sequence (F: upstream, R: downstream) sox9b F: TGGACCCCTACCTGAAGATG; R: AGTCCAGTCGTAGCCCTTGA fshr F: GTGGTGCTGGTGTTGCTGCTTA; R: TGGACGAGTGAGTAGATAGTGCCTTC clu F: TCTCTGCTCTGTGTCTTATC; R: AACTT...

Embodiment 3

[0055] Example 3 Induction of spermatogonial stem cells from the anchovy sex gland cells

[0056] 1. Cultivation of Spermia Stem Cells

[0057] A. Isolation and Digestion of Testicular Cells from Snormouth Fish

[0058] Take juvenile horse mouth fish, soak the fish body in PBS containing 0.5% bleaching powder for 1 min, wash with PBS containing 1% double antibody for 3 times, and then dissect. Cut the belly of the fish with scissors, carefully clip out the testis with tweezers, place it in a petri dish containing 1% double-antibody PBS, carefully peel off the fat tissue on the surface of the testis with tweezers, wash 3 times with PBS containing 1% double-antibody, and transfer the testis Transfer to a 1.5mL EP tube containing 500μL of trypsin, cut the tissue properly with scissors, and place it on ice for digestion. After 1 h, 1 mL of medium was added to stop the digestion, and the tissue pieces were gently blown away with a pipette gun, and the cell suspension was transfer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to establishment and application of a coilia ectenes gonad somatic cell line. The method comprises the following steps: (1) separating and digesting gonad tissues of coilia ectenes, and collecting the cells for plank culturing; and (2) after the cells are adhered to the wall, carrying out passage culture for 45-60 generations in sequence. The obtained coilia ectenes gonad somatic cell line can be stably passaged and proliferated, and can induce fish spermatogonial stem cells to differentiate in vitro to generate sperms.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the establishment and application of the sex gland cell line of the anchovy anchovy. Background technique [0002] The gonad is crucial to the reproduction of vertebrates. The gonad is composed of germ cells, supporting cells and stromal cells. The supporting cells and stromal cells are collectively called soma cells. The germ cells eventually develop and produce gametes, the supporting cells wrap the germ cells, promote the growth, development and gamete production of the germ cells, and the supporting cells are close to the mesenchymal cells. Several types of cells interact to maintain the normal development and physiological functions of the gonads. [0003] Spermatogonial stem cells (SSCs) are the basis of spermatogenesis and are crucial to the transmission of genetic information. Fish, like other hermaphrodites, have a high capacity for self-renewal and differentiation in thei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/071C12N5/076C12R1/91
CPCC12N5/0683C12N5/061C12N2500/30C12N2500/80C12N2501/115C12N2500/32C12N2502/246Y02A40/81
Inventor 李名友仲颖郭婧阚宇婷刘东
Owner SHANGHAI OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More