Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CRISPR/Cas9 library high-throughput screening method for brain metastasis related genes

A screening method and technology for brain metastases, applied in the field of cancer diagnosis, can solve problems that have not been raised by researchers

Pending Publication Date: 2021-06-08
FUDAN UNIV SHANGHAI CANCER CENT
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, no researchers have proposed how to apply CRISPR / Cas9 library screening technology to the study of brain metastasis of tumors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9 library high-throughput screening method for brain metastasis related genes
  • CRISPR/Cas9 library high-throughput screening method for brain metastasis related genes
  • CRISPR/Cas9 library high-throughput screening method for brain metastasis related genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Paired samples of breast cancer primary tumors and brain metastases were collected from 5 triple-negative breast cancer patients with simple brain metastases, a total of 5 pairs of 10 samples. Use the RNA-Quick Purification Kit (ES Science #RN001) kit to extract sample RNA and perform RNA-Seq detection. The detection results of RNA-seq were analyzed, and the Fold change value was greater than 1.5 at the same time as the screening condition to screen differentially expressed genes, and a total of 597 highly expressed genes in brain metastases were obtained (as shown in Table 1).

[0038] Table 1 Genes associated with brain metastasis of triple-negative breast cancer

[0039]

[0040]

Embodiment 2

[0042] According to the sgRNA online design software (http: / / crispr.mit.edu / ), 6 sgRNAs were designed for each gene in Example 1. Each sgRNA is 20bp, and a 27bp homology arm is added on the left and right sides of the sgRNA (the sequence of the left homology arm is ATATCTTGTGGAAAGGACGAAACACCG (SEQ ID NO: 1), and the sequence of the right homology arm is GTTTTAGAGCTAGAAATAGCAAGTTAA (SEQ ID NO :2)), for example figure 2 shown. In situ synthesis of oligonucleotide probe pools targeting multiple genes on a high-throughput chip.

Embodiment 3

[0044] 1. Amplify the oligonucleotide probe pool

[0045] Add TE Buffer to the powder of the oligonucleotide probe pool to resuspend, and use the following reaction system for polymerase chain reaction (polymerase chain reaction, PCR):

[0046] The PCR amplification program is:

[0047]

[0048] The PCR amplification system is:

[0049]

[0050] Primers are:

[0051] A. Forward primer:

[0052] GTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 3)

[0053] B. Reverse primer:

[0054] ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 4)

[0055] 2. Digest the lentiGuide-puro vector

[0056] Enzyme cutting system:

[0057]

[0058] Enzyme digestion system temperature setting:

[0059] Step1: 90 minutes at 55°C

[0060] Step2: 4°C°

[0061] The digested product was subjected to DNA electrophoresis on 2% agarose gel, and the 10,000 bp band was excised and recovered by Fastpuregel DNA Extraction Mini Kit (Novizyme #DC301...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9 library high-throughput screening method for brain metastasis related candidate genes. The method comprises the following steps of constructing an sgRNA library of the brain metastasis related genes, carrying out lentivirus packaging on the sgRNA library, infecting host cells stably expressing CAS9 protein, and performing screening to obtain cells stably expressing the sgRNA library; then, inoculating cells infected by lentivirus into the intracranial and fat pad of an immunodeficient mouse; and finally, taking out tumor tissues of intracranial tumorigenesis and subcutaneous tumorigenesis, extracting genomic DNA, carrying out next-generation sequencing and library establishment on a target region of sgRNA, and further finding out the brain metastasis related candidate genes by the abundance change of the sgRNA before and after screening. According to the method, the brain metastasis related gene high-throughput screening technology is established, the key genes for regulating and controlling brain metastasis can be accurately and efficiently excavated, and a new target spot and a new way are provided for prevention and treatment of brain metastasis.

Description

technical field [0001] The invention belongs to the technical field of cancer diagnosis and relates to a high-throughput screening method for a CRISPR / Cas9 library of brain metastasis-related genes. Background technique [0002] The CRISPR / Cas9 system consists of two components, Cas9 protein and sgRNA (single guide RNA). The sgRNA can recognize the complementary sequence with the PAM (protospacer adjacent motif) sequence, and the Cas9 protein can cut the target DNA sequence. Therefore, the Cas9 / sgRNA system can guide the Cas9 protein to recognize and cut the specific double DNA sequence with the sgRNA target through the sgRNA. Strands of DNA, resulting in the insertion or deletion of gene sequences, and ultimately the directional editing of genes. The CRISPR / Cas9 library is to design 3-10 sgRNAs for each gene, use the chip to synthesize sgRNA libraries targeting hundreds or even tens of thousands of genes at one time, and infect host cells stably expressing Cas9 protein wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6809C12Q1/6886C12N15/11
CPCC12Q1/6809C12Q1/6886C12Q2600/158C12Q2535/122
Inventor 张剑林明曦金奕滋
Owner FUDAN UNIV SHANGHAI CANCER CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com