Rubber tree ubiquitin gene promoter proHbUBI2 and cloning and application thereof
A technology of ubiquitin gene, prohbubi2-hgfp-pc3301, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Obtaining of Hevea brasiliensis Ubiquitin Gene Promoter proHbUBI2
[0045] Taking the full-length CDS sequence of the rice OsUBI10 gene (Genebank accession number: XM_015769228.1) as a reference, we searched the rubber tree genome database we established, and found a rubber tree ubiquitin gene with a homology greater than 80% ( Genebank accession number: XM_021810141.1), named it HbUBI2. The comparison of the nucleotide sequence of the rubber tree HbUBI2 gene and the rice OsUBI10 gene coding region is as follows: figure 1 As shown, the results show that the rubber tree HbUBI2 gene has a very high sequence homology with the rice OsUBI10.
[0046] Using the rubber tree gene expression database (http: / / hevea.catas.cn / tool / v1 / toExpression) to obtain the expression pattern of the HbUBI2 gene, it was found that the gene is present in most tissues (such as leaves, bark, latex, etc.) of the main rubber tree strains. , lactiferous ducts, flowers and seeds, etc.) have...
Embodiment 2
[0053] The construction of embodiment 2 rubber tree transient expression vectors
[0054] In this example, the obtained promoter proHbUBI2 was constructed on the transient expression vector pJIT163-hGFP to replace the 2×35S promoter on the vector, specifically including the following steps:
[0055] (1) Design the following primers to introduce SacI and NcoI restriction sites at the 5' and 3' ends of the proHbUBI2 sequence respectively. The primers are designed as follows:
[0056] proHbUBI2-sF: AGCGAGCTCGAACCAATCCTGGCTGTGG;
[0057] proHbUBI2-nR: ATGCCATGGCTGTTTAGCAGAAAGAAAGC;
[0058] (2) Using the rubber tree genomic DNA as a template, use KOD FX enzyme (TOYOBO) to carry out PCR amplification in a 20 μl reaction system. The specific reaction procedure is: pre-denaturation at 95°C for 2 minutes, denaturation at 98°C for 10 seconds, annealing at 56°C for 30 seconds, and 72°C Extend for 2 minutes, 35 cycles, and finally extend for 5 minutes at 72°C; purify and recover the am...
Embodiment 3
[0060] The construction of embodiment 3 Hevea stable transformation expression vector
[0061] In this example, the promoter proHbUBI2 was constructed into the stable transformation expression vector pCAMBIA3301, specifically by further constructing the proHbUBI2::hGFP expression cassette on the transient expression vector proHbUBI2-163hGFP prepared in Example 2 into the stable transformation vector pCAMBIA3301 , specifically include the following steps:
[0062] (1) Design primers to introduce SacI and PstI restriction sites at the 5' and 3' ends of the proHbUBI2::hGFP expression cassette respectively. The primers were designed as follows:
[0063] proHbUBI2-sF: AGCGAGCTCGAACCAATCCTGGCTGTGG;
[0064] CaMVT-pR: CCCTGCAGCGGTGTGAGGGAACTAG;
[0065] (2) Using the prepared proHbUBI2-163hGFP plasmid DNA as a template, use KOD FX enzyme (TOYOBO) to perform PCR amplification in a 20 μl reaction system; the specific reaction program is: pre-denaturation at 95°C for 2 minutes, denatu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More