Mutant genes for regulating and controlling female development of rice, proteins encoded by mutant genes, application of mutant genes and primers

A gene encoding and mutation technology, applied in the field of genetic engineering, can solve the problems of less utilization and less female sterility genes

Active Publication Date: 2021-06-29
HUNAN HYBRID RICE RES CENT
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few female sterility genes reported in rice, and even fewer genes can be used in breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant genes for regulating and controlling female development of rice, proteins encoded by mutant genes, application of mutant genes and primers
  • Mutant genes for regulating and controlling female development of rice, proteins encoded by mutant genes, application of mutant genes and primers
  • Mutant genes for regulating and controlling female development of rice, proteins encoded by mutant genes, application of mutant genes and primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Discovery of OsMLH1 mutant genes Osmlh1-1 and Osmlh1-2 that regulate rice female development

[0036] The full-length CDS (2175bp) sequence of the unmutated rice OsMLH1 gene is shown in SEQ ID No.1, and the unmutated protein sequence (724aa) encoded by the rice OsMLH1 gene is shown in SEQ ID No.2.

[0037] Through sequence alignment and target site rules, a specific target site 5'ATCGATGGGGTTCAGAGGGGAGG3' was selected on the second exon of the OsMLH1 gene, and the Cas9 gene editing vector system of monocotyledonous plants of Liu Yaoguang's team was selected: the CRISPR / gRNA vector was pYL- U3 / U6a~c-gRNA, the CRISPR / Cas9 binary vector is pYLCRISPR / cas9-MT (I), first design the target site linker primers (including upstream primer gRNA-F and downstream primer gRNA-R, respectively as SEQ ID NO. 9 and shown in SEQ ID NO.10):

[0038] gRNA-F: GGCATCGATGGGGTTCAGAGGGG;

[0039] gRNA-R: AAACCCCCTCTGAACCCCATCGA;

[0040] Ligated and amplified with the gRNA expressi...

Embodiment 2

[0049] Example 2: Discovery of OsMLH3 mutant genes Osmlh3-1 and Osmlh3-2 that regulate rice female development

[0050] The full-length CDS (3588bp) sequence of the unmutated rice OsMLH3 gene is shown in SEQ ID No.7, and the unmutated protein sequence (1195aa) encoded by the rice OsMLH3 gene is shown in SEQ ID No.8. According to the sequence alignment analysis and the target site rules, the target site 5'ATCCAAGTTTCATAATGTCATGG3' was selected in the fifth exon of the OsMLH3 gene to construct the Cas9 gene editing vector, and the indica rice Huazhan (HZ) was transformed by the Agrobacterium-mediated method to obtain Positive plants in the T0 generation were harvested and the seeds of the positive plants were planted in the T1 generation. After target site sequencing analysis, the homozygous mutants for the target point in the T1 generation were obtained, and the homozygous lines Osmlh3-1 and Osmlh3-2 for the target point mutation were obtained by further propagation.

[0051] T...

Embodiment 3

[0054] Example 3: In vivo fluorescent bimolecular (BiFC) assay

[0055] The BiFC vectors for fluorescent bimolecular interaction research are pCAMBIA1300-35S-YFPn and pCAMBIA1300-35S-YFPc. The specific test process is as follows:

[0056] 1. Extract RNA from the ear of indica rice variety G99, reverse transcribe it into cDNA, use this cDNA as a template, use high-fidelity enzyme (KOD) PCR to amplify the OsMLH1 gene; Recover the purified carrier, mix it with the PCR product of OsMLH1 gene, use the seamless cloning method to construct the pCAMBIA1300-35S-OsMLH1-YFPc vector, the upstream and downstream primers used in this PCR amplification are (respectively as SEQ ID NO.13 and SEQ ID NO .14):

[0057] YC-MLH1-BamHI-F:TCTGATCAAGAGACAGGATCCATGGACGAGCCTTCGCCGCG;

[0058] YC-MLH1-SalI-R: CATCGGTGCACTAGTGTCGACACACCTTTCAAAAATCTTGTA;

[0059] Digestion reaction: BiFC carrier 16 μL; 10× FastDigest buffer 2 μL; FastDigest BamHI 1 μL; FastDigest SalI 1 μL; react at 37°C for 30 min;

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses mutant genes for regulating and controlling female development of rice, and the mutant genes are a mutant gene Osmlh1-1 and mutant gene Osmlh1-2 on an OsMLH1 gene, and a mutant gene Osmlh3-1 and mutant gene Osmlh3-2 on an OsMLH3 gene. Proteins encoded by the genes of the several mutation types have an obvious effect in the aspect of controlling the fertility of female organs of the rice, the edited mutants Osmlh3 and Osmlh1 of the genes have similar phenotypes, the maturing rate of the mutant Osmlh3 and the maturing rate of the mutant Osmlh1 are both reduced to about 10%; a female sterility restoring line of the rice can be generated by utilizing the mutant genes through a genetic engineering means, and the female sterility restoring line is used for producing hybrid seeds, and developing recurrent selection; and the genes have very important application prospects in agricultural production. The invention further discloses proteins encoded by the mutant genes, application of the proteins to regulation and control of female development of rice, and a primer pair for amplifying the genes.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a mutant gene for regulating female development of rice, its encoded protein and its application, and primers for amplifying the mutant gene. Background technique [0002] Mismatch Repair (MMR) is a key mechanism that affects biological genetic variation. It is mainly responsible for DNA synthesis, genetic recombination, and repair of single and few base deletions, insertions, and mismatches in the genome during the damage process. It is important for maintaining DNA replication fidelity and Genome stability is crucial (Cui Hairui et al., 2014). At present, the function of the mismatch repair system has been deeply studied in Arabidopsis, but the composition and molecular mechanism of the MMR system in rice are poorly understood. [0003] There are 10 mismatch repair genes in the higher plant Arabidopsis, namely AtMSH1, AtMSH2, AtMSH3, AtMSH6, AtMSH7, AtMS...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C12N15/82C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/8218C12N15/829
Inventor毛毕刚赵炳然彭彦韶也郑文杰胡远艺唐丽李曜魁张丹
OwnerHUNAN HYBRID RICE RES CENT