Unlock instant, AI-driven research and patent intelligence for your innovation.

A coding gene for improving plant cadmium tolerance and plant genetic engineering to remediate soil cadmium pollution

A technology for repairing soil and genetic engineering, applied in genetic engineering, plant genetic improvement, angiosperms/flowering plants, etc., can solve problems such as unrepaired

Active Publication Date: 2022-03-18
HEFEI UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional physical and chemical methods for such a large area of ​​contaminated soil are difficult to implement due to economic or technical reasons, and are currently in an unrepaired state.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A coding gene for improving plant cadmium tolerance and plant genetic engineering to remediate soil cadmium pollution
  • A coding gene for improving plant cadmium tolerance and plant genetic engineering to remediate soil cadmium pollution
  • A coding gene for improving plant cadmium tolerance and plant genetic engineering to remediate soil cadmium pollution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1, T-DNA insertion mutant myb43 the acquisition and identification of

[0020] We purchased from the Arabidopsis Biological Resource Center (https: / / abrc.osu.edu / ) SALK_023509C ( myb43) strain mutants. Primers for mutant identification were designed, myb43-F: GACCATCTGCACACACACAC and myb43-R: CCATCTCACTCCCTACTGATTCC. The DNA of the 4-week-old mutant plants was extracted, and the homozygotes were identified by PCR. In order to determine the exact insertion site of T-DNA, use the pROK2 vector primer and myb43-R amplified fragment to send to the company for sequencing, and NCBI will perform NucleotideBLAST comparison to determine the exact T-DNA insertion site and draw the mutant T-DNA insertion pattern picture. Such as figure 1 As shown in A, in the mutant myb43 In , the T-DNA is inserted in the first intron.

[0021] Extraction of 4 week homozygous mutants myb43 and the RNA of WT plants, reversed to obtain cDNA, determined by qRT-PCR MYB43 expr...

Embodiment 2

[0022] Example 2, myb43 Mutants are tolerant to Cd stress

[0023] right myb43 Carry out Cd stress experiment, the experimental results are as follows figure 2 A in figure 2 B in and figure 2 Shown in C. It can be seen from the figure that under normal conditions, myb43 Mutants were not different from wild type; when Cd (50 or 75 µMCdCl 2 ) under duress, myb43 The mutants showed obvious Cd stress tolerance. The root length and fresh weight of the plants were counted, myb43 Under stress conditions, the root length of the mutant was significantly longer than that of the wild type, and the fresh weight was also significantly greater than that of the wild type. This explains MYB43 Plays an important role in Cd stress.

[0024] for further verification MYB43 The function of genes in the regulation of plant heavy metal Cd stress, we constructed MYB43 Overexpression transgenic lines. The two lines with the highest expression levels were selected ( M-OE1 with ...

Embodiment 3

[0025] Embodiment 3, WT, myb43 mutant and MYB43 Determination of Cd content in roots and leaves of overexpressed plants

[0026] Cd tolerance and sensitivity phenotypes are closely related to the corresponding Cd content in plants. myb43 mutant, MYB43 The results of Cd content determination in the roots and leaves of overexpression plants are as follows: Figure 4 shown. It can be seen from the results that myb43 The Cd content of mutant roots was significantly lower than that of wild-type plants. However, compared with wild type, myb43 Higher concentrations of Cd accumulated in mutant leaves. MYB43 The Cd content in the overexpression plants and myb43 The Cd content in the mutant was just the opposite.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a coding gene that enhances plant cadmium tolerance and promotes the transfer of cadmium ions from roots to leaves, and belongs to the technical field of plant restoration genetic engineering. The coding gene sequence for enhancing plant cadmium tolerance and promoting the transfer of cadmium ions from roots to leaves is shown in SEQ ID No: 1 in the sequence table. The present invention uses T-DNA insertion mutation technology to mutate the coding gene in plants that enhances plant cadmium tolerance and promotes the transfer of cadmium ions from roots to leaves, so that the above-mentioned plants in plants are resistant to cadmium and increase the coding of cadmium transporters in plants. The expression of the gene increased, thereby prompting the plant to transport cadmium from the root to the leaf storage, which is less toxic to the plant, and then showed tolerance to cadmium. The related protein and its coding gene for enhancing plant cadmium tolerance and promoting the transfer of cadmium ions from roots to leaves of the present invention can provide genetic resources and technical support for plant restoration genetic engineering technology to improve soil heavy metal pollution.

Description

technical field [0001] The invention belongs to the technical field of phytoremediation genetic engineering, and specifically relates to a coding gene and its application that enhances plant cadmium tolerance and promotes the transfer of cadmium ions from roots to leaves, and particularly relates to the use of the mutation of the coding gene to enhance plant tolerance to cadmium poisoning and its application. Using phytoremediation technology to improve soil heavy metal pollution. Background technique [0002] Soil heavy metal pollution is one of the current global environmental problems, and it is a thorny problem facing the world today. Since heavy metal pollution is an irreversible process, heavy metal pollutants stay in the soil for a long time, and plants or microorganisms cannot degrade them. After excessive accumulation of heavy metals in the edible parts of crops, they are easy to pass to humans or animals through the food chain, which is harmful to human health. ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/20
CPCC07K14/415C12N15/8271
Inventor 曹树青郑朋朋曹蕾李亚平樊婷婷江力潘伟成于鑫
Owner HEFEI UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More