SNP (Single Nucleotide Polymorphism) molecular marker for predicting low-fructose peaches and detection method
A technology of molecular markers and fructose, applied in the field of plant molecular biology, can solve the problems of low labeling effect and lack of repeatability, etc., and achieve accurate detection results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1: Determination and grading evaluation of peach fruit fructose content
[0038] Ripe fruit samples were collected for detection of fructose content. The samples came from the National Peach Germplasm Resource Garden (Beijing). When the shape of the fruit no longer expands, the background color fades, and the flesh begins to soften, it is judged as a ripe fruit. The mesocarp tissue of each fruit was cut by quartering method, and 10 fruits of each variety were collected for mixing and homogenization. Weigh about 300mg of the homogenized mixture, add the corresponding volume of absolute ethanol at a ratio of 3:7 (m / v), mix thoroughly and centrifuge at 8,050×g for 5 minutes. The supernatant was aspirated and filtered with a PVDF filter membrane (0.22 μM). The filtrate was collected by a high-performance liquid chromatography system (LC-20A, Shimadzu), and the fructose content in the fruit was converted according to the standard curve.
[0039] Since the fructose...
Embodiment 2
[0042] Example 2: Mining of peach fructose-associated SNPs
[0043] In order to obtain accurate phenotype-associated sites, the present invention uses the third-generation Pacbio sequencing platform (depth 120.1×), combined with the second-generation Illumina resequencing data (depth 107.7×), and Hi-C data (depth 147.25×) to assist, Completed the de novo assembly of the high-quality genome of the peach variety "Longhua Shuimi". Compared with the existing peach reference genome Lovell 2.0, this genome is superior to Lovell 2.0 in terms of sequence consistency, completeness, accuracy and gene coverage. Taking Longhua honey as the reference genome, combined with the high-depth resequencing data (average depth 26.3×) of the above-mentioned 364 cultivated peach varieties covering all major production areas for SNP detection, 6.97M SNP sites were screened, and using genome-wide association analysis, A SNP located at 11,910,990bp on chromosome 1 was found to have a strong correlatio...
Embodiment 3
[0045] Embodiment 3: the establishment of KASP detection system
[0046] According to the 50bp sequence before and after the SNP-Fru site (CACAAGTAAAGGTCCAAGTCTCAAGTGGTATATCACATTCTAGGTTTATT[C / G]TGTGTTTTTTTTTACAGGACCCTTTGCATTGCAACTCAGTCAAACTAGAGA), the KASP primer combination was designed, which consisted of 3 primers, including two upstream forward primers, respectively connected to VIC (P1) and FAM (P2 ) fluorescent label, a reverse primer (P3) downstream:
[0047] P1: GAAGGTCGGAGTCAACGGATTAAGTGGTATATCACATTCTAGGTTTATTC
[0048] P2: GAAGGTGACCAAGTTCATGCTAGTGGTATATCACATTCTAGGTTTATTG
[0049] P3: GGTAAGTCTCTAGTTTGACTGAGTTGC.
[0050] Each primer was dissolved in sterile water and diluted to 100 μM, and mixed according to the ratio of P1:P2:P3:water=24:24:48:100 for later use.
[0051] 1. SNP typing detection method
[0052] 1) Configure the PCR reaction system and perform the amplification reaction:
[0053] Collect young peach leaves, use high-efficiency plant genomic DNA ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


