Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP (Single Nucleotide Polymorphism) molecular marker for predicting low-fructose peaches and detection method

A technology of molecular markers and fructose, applied in the field of plant molecular biology, can solve the problems of low labeling effect and lack of repeatability, etc., and achieve accurate detection results

Active Publication Date: 2021-07-23
BEIJING AGRO BIOTECH RES CENT
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the selected research groups are different, and the trait is closely related to the growth environment of fruit trees, and is greatly affected by factors such as light, rain, and planting techniques, most of these loci lack reproducibility, and the marker effect is not high. Difficult to get practical application in breeding
So far, there is still a lack of effective technical means to accurately predict the sweet taste of peach fruit at the seedling stage, and the quality of sweetness is one of the most important breeding goals of fruit. Therefore, the development of molecular markers that can accurately predict these complex traits , will help to achieve the realistic goal of efficient molecular assisted breeding, and is in line with the current scientific and technological development direction of high-quality development of economic crops and industrial quality improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP (Single Nucleotide Polymorphism) molecular marker for predicting low-fructose peaches and detection method
  • SNP (Single Nucleotide Polymorphism) molecular marker for predicting low-fructose peaches and detection method
  • SNP (Single Nucleotide Polymorphism) molecular marker for predicting low-fructose peaches and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Determination and grading evaluation of peach fruit fructose content

[0038] Ripe fruit samples were collected for detection of fructose content. The samples came from the National Peach Germplasm Resource Garden (Beijing). When the shape of the fruit no longer expands, the background color fades, and the flesh begins to soften, it is judged as a ripe fruit. The mesocarp tissue of each fruit was cut by quartering method, and 10 fruits of each variety were collected for mixing and homogenization. Weigh about 300mg of the homogenized mixture, add the corresponding volume of absolute ethanol at a ratio of 3:7 (m / v), mix thoroughly and centrifuge at 8,050×g for 5 minutes. The supernatant was aspirated and filtered with a PVDF filter membrane (0.22 μM). The filtrate was collected by a high-performance liquid chromatography system (LC-20A, Shimadzu), and the fructose content in the fruit was converted according to the standard curve.

[0039] Since the fructose...

Embodiment 2

[0042] Example 2: Mining of peach fructose-associated SNPs

[0043] In order to obtain accurate phenotype-associated sites, the present invention uses the third-generation Pacbio sequencing platform (depth 120.1×), combined with the second-generation Illumina resequencing data (depth 107.7×), and Hi-C data (depth 147.25×) to assist, Completed the de novo assembly of the high-quality genome of the peach variety "Longhua Shuimi". Compared with the existing peach reference genome Lovell 2.0, this genome is superior to Lovell 2.0 in terms of sequence consistency, completeness, accuracy and gene coverage. Taking Longhua honey as the reference genome, combined with the high-depth resequencing data (average depth 26.3×) of the above-mentioned 364 cultivated peach varieties covering all major production areas for SNP detection, 6.97M SNP sites were screened, and using genome-wide association analysis, A SNP located at 11,910,990bp on chromosome 1 was found to have a strong correlatio...

Embodiment 3

[0045] Embodiment 3: the establishment of KASP detection system

[0046] According to the 50bp sequence before and after the SNP-Fru site (CACAAGTAAAGGTCCAAGTCTCAAGTGGTATATCACATTCTAGGTTTATT[C / G]TGTGTTTTTTTTTACAGGACCCTTTGCATTGCAACTCAGTCAAACTAGAGA), the KASP primer combination was designed, which consisted of 3 primers, including two upstream forward primers, respectively connected to VIC (P1) and FAM (P2 ) fluorescent label, a reverse primer (P3) downstream:

[0047] P1: GAAGGTCGGAGTCAACGGATTAAGTGGTATATCACATTCTAGGTTTATTC

[0048] P2: GAAGGTGACCAAGTTCATGCTAGTGGTATATCACATTCTAGGTTTATTG

[0049] P3: GGTAAGTCTCTAGTTTGACTGAGTTGC.

[0050] Each primer was dissolved in sterile water and diluted to 100 μM, and mixed according to the ratio of P1:P2:P3:water=24:24:48:100 for later use.

[0051] 1. SNP typing detection method

[0052] 1) Configure the PCR reaction system and perform the amplification reaction:

[0053] Collect young peach leaves, use high-efficiency plant genomic DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for predicting the fructose content level of peaches through SNP (Single Nucleotide Polymorphism) molecular markers. A marker site is base at 11, 910, 990bp site of peach chromosome 1. When the genotype is the GG genotype, 100% of the peach variety to be detected is low in fructose when the site is CG, about 90.9% of the peach variety to be detected is low in fructose; and when the locus is CC, about 9.8% of the peach variety to be detected is low in fructose. The method provided by the invention can be used for early prediction of peach fructose, selection of cross parents and identification of variety resources, can be used for breeding of targeted peach varieties, and has a wide application prospect.

Description

technical field [0001] The invention relates to the fields of plant molecular biology, bioinformatics and plant molecular breeding, in particular to a SNP molecular marker and a detection method for predicting low-fructose peaches. Background technique [0002] Peach is a perennial woody plant widely grown in subtropical regions and is one of the important economic fruit trees. my country is the world's largest peach-producing country. According to the latest statistics from the World Food and Agriculture Organization (FAOSTAT), my country's total peach production in 2019 was 15.842 million tons, accounting for 61.55% of the world's total production. Sugar content is one of the main factors affecting fruit quality. Secondly, the different proportions of sugar components also affect the sweet taste of the fruit. The sweetness of fructose is 1.7 times that of sucrose, and it is one of the sweetest sugars among all natural sugars (Kroger, M., Meister, K., & Kava, R. Low-calor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 徐摇光谢华于洋官健涛
Owner BEIJING AGRO BIOTECH RES CENT