African horse sickness virus RNA qualitative standard sample, application and preparation method

A standard sample, pestivirus technology, applied in the field of inspection and quarantine

CN113388702APending Publication Date: 2021-09-14INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
Publication Date
2021-09-14

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention belongs to the technical field of inspection and quarantine, and particularly relates to an African horse sickness virus RNA qualitative standard sample, and further relates to application and a preparation process of the standard sample. The African horse sickness virus RNA qualitative standard sample is characterized in that the nucleic acid sequence of the standard sample is shown as SEQ ID NO.1. The nucleic acid sequence encodes African horse sickness virus nucleoprotein VP7. The invention further protects application of the African horse sickness virus RNA qualitative standard sample in preparation of an African horse sickness nucleic acid detection kit. The nucleic acid standard sample free of biological infectivity is provided for detecting African horse sickness virus real-time fluorescence RT-PCR, and detection of African horse sickness virus is facilitated. The standard sample obtained through the method is good in uniformity, the characteristic value of the standard sample simulates the consistency of measured values under the conditions of 37 DEG C and 42 DEG C, no remarkable change occurs, and the property is stable.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the technical field of inspection and quarantine, and in particular relates to a qualitative standard sample of African horse sickness virus RNA, and also relates to the application and preparation method of the standard sample. Background technique

[0002] African equine sickness is an acute or subacute arboreal (arthropod) viral disease mainly affecting equines (horses, donkeys and related animals), which often has pathogenic effects in susceptible horse herds. Should the virus emerge, it would cause huge economic losses and a devastating blow to the modern horse industry.

[0003] Nucleic acid standard samples are currently a very scarce testing resource, which poses a great obstacle to the detection of animal diseases. As a detection disease listed by OIE, African horse sickness has always been highly valued in its detection and monitoring. At present, the pathogenic detection of the virus is mainly carried out by molecu...

Examples

Embodiment 1

[0062] The process flow chart for the preparation of standard samples for the qualitative detection of African horse sickness virus is attached figure 1 As shown, it mainly includes: sample (i.e. the standard sample mentioned in the present invention) preparation, detection, subpackaging, and preliminary uniformity detection; after the standard sample is tested for stability and uniformity, it enters the standard value determination link (abbreviated as Value determination), that is, a number of authoritative laboratories collaborate to determine the value, then save the standard and determine the validity period of the standard sample.

[0063] The standard sample provided by the present invention, its main synthesis method is as follows:

[0064] A segment of sequence (GGGCGATAATACGACTCACTATAG GGG) was extended on both sides of the 186bp target sequence of the designed African horse sickness virus VP7, and was constructed on the pBlueScript vector (containing T7 transcript) ...

Embodiment 2

[0119] Uniformity Test

[0120] 2.1 Requirements for variance analysis of homogeneity test

[0121] The prepared standard sample needs to check its homogeneity, and the homogeneity inspection utilizes the analysis of variance method, and adopts the F test to carry out the single factor analysis of variance, and the homogeneity analysis of variance result (S bb ) is compared with the expected target of the characteristic value, if not significant, the standard sample is considered uniform.

[0122] draw number press (N is the total number of units) calculations. The total number of minimum packaging units in this project is about 200 bottles.

[0123] Take i samples (i=1, 2, 3, ... m), and test each sample j times (j = 1, 2, 3, ... n) under repeated conditions.

[0124] Test average for each sample

[0125] Overall average of all samples tested

[0126] Total number of tests

[0127] Between-sample sum of squares mean square

[0128] In-sample sum of squares ...

Embodiment 3

[0150] stability test

[0151] 3.1 Long-term stability test

[0152] According to the biological characteristics of the virus and previous experience, the standard samples were stored at -20°C for a period of 2 years, and four samples were taken from the prepared standard samples in stages for determination. Randomly select samples for stability test, and perform real-time fluorescent RT-PCR test at 0, 3, 6, 9, 12, 15, 18, 21, 24, and 39 months, respectively. According to OIE Terrestrial Manual (2019) Chapter 3.5.1African horse sickness (infection with African horsesickness virus) real-time fluorescent RT-PCR detection of each tube sample. Fluorescence signal is collected during annealing of each cycle. After the detection, according to the amplification curve and Ct When the positive control and negative control are both normal, if the Ct value ≥ 40, it can be judged that the gene amplification result is negative; if the Ct value is < 40, the gene amplification result can be...