Unlock instant, AI-driven research and patent intelligence for your innovation.

Cracking agent suitable for direct amplification of DNA or RNA virus, kit and application of cracking agent and kit in PCR detection of virus

An RNA virus and lysing agent technology, applied in the field of DNA or RNA virus PCR detection kits, can solve problems such as long time consumption, cross-contamination, shortening extraction time, etc., and achieve the effect of improving detection efficiency and effective release

Pending Publication Date: 2021-09-28
YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Column extraction can obtain high-purity nucleic acids, but the extraction steps are cumbersome, requiring multiple centrifuges, and the entire process takes a long time
Magnetic bead extraction combined with automatic extraction equipment can greatly shorten the extraction time compared with column extraction, but there is a risk of cross-contamination in the simultaneous operation of multiple samples, and the cost of extraction equipment and reagents is also relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cracking agent suitable for direct amplification of DNA or RNA virus, kit and application of cracking agent and kit in PCR detection of virus
  • Cracking agent suitable for direct amplification of DNA or RNA virus, kit and application of cracking agent and kit in PCR detection of virus
  • Cracking agent suitable for direct amplification of DNA or RNA virus, kit and application of cracking agent and kit in PCR detection of virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The lysing agent in this example is composed of 20mM Tris-HCL pH8.0, 150mM guanidine hydrochloride, 0.5% Tween 20, 0.5% acetylcysteine, 2.5mM EDTA, 500U / ml RNasin.

[0031] The fresh culture of high-concentration HBV virus (quantified by Roche’s COBAS AmpliPrep / COBAS TaqManHBV Test, version 2.0 kit) was serially diluted with commercially available negative and clear serum to obtain 10 6 、10 5 、10 4 、10 3 For samples with a concentration of IU / ml, mix the lysing agent and the diluted sample 1:1, treat at room temperature for 5 minutes, and take 5 μl for subsequent qPCR amplification.

[0032] HBV primer probe:

[0033] HBV-F: 5’-GTGTCTGCGGCGTTTTATCA- 3’

[0034] HBV-R: 5’-GACAAACGGGCAACATACCTT- 3’

[0035] HBV-P: 5'- CCTCTTCATCCTGCTGCTATGCCTCATC - 3' (markers: 5'FAM, 3'BHQ1)

[0036] components Volume (μl) / reaction 5XPCR buffer 5 dNTP (10mM) 0.5 Taq DNase (5U / μl) 0.6 Primer HBV-F (10 μM) 1 Primer HBV-R (10 μM) 1 Probe...

Embodiment 2

[0041] The lysis reagent in this example consists of 20mM Tris-HCL pH8.0, 100mM guanidine isothiocyanate, 0.5% Tween20, 0.5% acetylcysteine, 2.5mM EDTA, 500U / ml RNasin.

[0042] Dilute Coxsackie A16 virus (one of the main pathogens of HFMD) to 10 with a negative throat swab sample 5 、10 3 Copies / ml, treated with lysis reagent and extracted with Qiagen RNeasy Mini Kit, 10 5 Copies / ml set 3 duplicate holes, 10 3 Copies / ml set 20 duplicate wells, then take 5 μl as a template for RT-qPCR detection.

[0043] Coxsackie A16 virus primer probe:

[0044] Cox A16-F: 5'-GAACCATCACTCCACACAGGAG-3'

[0045] Cox A16-R: 5'-GTACCTGTGGTGGGCATTG-3'

[0046] Cox A16-P: 5'-CAGCCATTGGGAATTTCTTTAGCCGTG-3' (Markers: 5'FAM, 3'BHQ1)

[0047] components Volume (μl) / reaction 5XPCR buffer 5 dNTP (10mM) 0.5 Taq DNase (5U / μl) 0.6 MMLV enzyme (200U / μl) 0.1 Rnasin (200U / μl) 0.1 Primer H1N1-F (10 μM) 1 Primer H1N1-R (10 μM) 1 Probe H1N1-P (10 μM)...

Embodiment 3

[0052] The lysing agent in this example consists of 20mM Tris-HCL pH8.0, 100mM guanidine hydrochloride, 0.5% Tween 20, 0.5% acetylcysteine, 2.5mM EDTA, 500U / ml RNasin.

[0053] Prepare 15 positive samples from throat swabs of Influenza A (H1N1) virus, treat them with lysing agent and extract with QiagenRNeasy Mini Kit in parallel. RT-qPCR detection for the template.

[0054] Influenza A H1N1 Influenza Virus Primer Probe:

[0055]H1N1-F:5'-GGACTGCAGCGTAGACGCTT-3'

[0056] H1N1-R:5'-CATCCTGTTGTATATGAGGCCCAT-3'

[0057] H1N1-P: 5'-CTCAGTTATTCTGCTGGTGCACTTGCCA-3' (Tag: 5'FAM, 3'BHQ1)

[0058] The RT-qPCR reaction system and procedure are the same as in Example 2.

[0059] The test results are shown in the table below:

[0060]

[0061] The detection results showed that 15 cases of influenza A H1N1 influenza virus throat swab positive samples were detected by both methods, and the Ct value showed that the detection ability of the lysing agent of the present invention to tre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cracking agent suitable for direct amplification of DNA or RNA viruses. The cracking agent comprises Tris-HCl, chaotropic salt, a surfactant, a reducing agent, EDTA and an RNA enzyme inhibitor Rnasin. When the lysing agent is used for treating samples such as serum, plasma, nasal swabs, pharyngeal swabs, sputum and alveolar lavage fluid, virus nucleic acid can be rapidly and effectively released under the room temperature condition, lysate can be directly used for qPCR amplification, a nucleic acid extraction step is not needed, the detection efficiency is greatly improved, and the whole time is shortened from 3 hours to 1.5 hours.

Description

technical field [0001] The invention relates to a lysing agent suitable for direct amplification of DNA or RNA viruses and its application in virus PCR detection, and a corresponding DNA or RNA virus PCR detection kit, belonging to the field of biotechnology. Background technique [0002] Nucleic acid detection has the characteristics of high sensitivity, strong specificity, short time consumption, and ability to monitor virus activity, and has been widely used in clinical testing. However, clinical samples contain a large amount of nucleic acid amplification interfering substances, so nucleic acid extraction and purification must be performed on samples before nucleic acid amplification. [0003] At present, the main nucleic acid extraction methods include silica gel membrane adsorption column method and magnetic bead method. Column extraction can obtain high-purity nucleic acids, but the extraction steps are cumbersome, requiring multiple centrifuges, and the entire proce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6806C12Q1/6851C12Q1/70C12R1/93
CPCC12Q1/6806C12Q1/6851C12Q1/706C12Q1/701C12Q2527/125C12Q2527/127C12Q2531/113C12Q2521/107C12Q2563/107
Inventor 沈小波孙晓亮苏杰
Owner YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD