Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for obtaining human Floor Plate cells and application of human Floor Plate cells

A basal plate and human embryonic stem cell technology, applied in the field of central nervous system basal plate cells, can solve the problems of high price, unstable FP efficiency, and unstable concentration, and achieve the effect of improving differentiation stability and efficiency

Active Publication Date: 2021-10-12
SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE +1
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The deficiencies in the various methods of using human embryonic stem cells to differentiate human basal plate cells that have been reported mainly include: the classic differentiation method needs to add a high concentration of protein SHH on the first day of differentiation, and the existence of protein SHH is expensive and due to the difference between production batches and The disadvantage of unstable concentration caused by preservation means, which will lead to instability of FP efficiency in differentiation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining human Floor Plate cells and application of human Floor Plate cells
  • Method for obtaining human Floor Plate cells and application of human Floor Plate cells
  • Method for obtaining human Floor Plate cells and application of human Floor Plate cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1 Culture of human embryonic stem cell line H9

[0060] The human embryonic stem cell line H9 (H9 based on MTA number: WiCell Agreement No: 21-W0349) was cultured in Matrigel-coated well plates, cultured in E8 medium, and the medium was replaced every day, and cultured to 80% density for about 7 days. Perform 1:12 passage expansion operation or cryopreservation operation.

[0061] Both subculture and cryopreservation need to use DPBS to wash off excess medium, then add digestive enzyme ReleSR to the well, absorb the digestive solution within 1 minute, digest at room temperature for 7 minutes, add an appropriate amount of E8 to stop digestion, and tap the well plate to remove the cells. Pat it off and get about 0.1cm 2 Large or small cell clumps, passage to a new well plate at 1:12, or add the prepared cryopreservation solution (E8:FBS:DMSO=7:2:1) to collect cells into cryopreservation tubes Transfer to a -80°C refrigerator for pre-cooling for 24 hours, and ...

Embodiment 2

[0062] Example 2 Construction and sequencing verification of inducible overexpression vector AAVS1-TRE3G-NKX2.2

[0063] AAVS1-TRE3G-NKX2.2 plasmid construction: The CDS region of NKX2-2 (NCBI Reference Sequence: NP_002500.1) was obtained from pENTER-NKX2.2 (vigene bioscienceNM_002509) by PCR method, and the upstream and downstream primers were NKX2.2-CDS -Forward (GCACCAAAATCAACGGGACTTTCC, SEQ ID NO 1) and NKX2.2-CDS-Reverse (CCTCTACAAATGTGGTATGGC, SEQ ID NO 2), use 2×fast pfu mix (Novoprotein) for PCR, annealing temperature is 60°C, 50 μL PCR reaction system reaction End purification using a purification kit and concentration measurement using a microplate reader. Homologous recombination Use a homologous recombination kit to carry out homologous recombination according to the concentration of the purified vector after enzyme digestion and the concentration of the insert fragment at 1:3. After purification, transform into competent E. coli, extract the plasmid with a small e...

Embodiment 3

[0065] Example 3 Plasmid transfection and clone identification of human embryonic stem cell line H9 cells

[0066]Human embryonic stem cells H9 cell line was transfected by electroporation. Prepare cells to be electroporated first: use E8 medium to culture H9 cells on Matrigel-coated dishes, and culture the cells at a density of about 80%, and add Y-27632 (Sigma-Aldrich #688001) one day before electroporation.

[0067] The human embryonic stem cell line H9 after electroporation was cultured on mouse embryonic fibroblasts (MEFs) treated with X-rays, and the MEF cells should be revived one day in advance to a gelatin-coated culture plate, using DMEM high Culture medium supplemented with 10% FBS and 1% PS in sugar for 24 hours. On the day of electroporation, wash the MEF prepared 24 hours ago with DPBS, and then add hESM containing Y-27632 and 50ng / mL growth factor bFGF to each well of the MEF culture plate. Treat the H9 to be electroporated, first wash away the residual medium...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for obtaining human Flooor Plate (FP) cells in vitro. The method comprises the following steps: a human embryonic stem cell line H9 is modified through a gene, and an NKX2.2-CDS region and an inducible Tet-on expression system are inserted into a human chromosome 19 to obtain a human embryonic stem cell line H9-iOE-NKX2.2, of which the NKX2.2 expression level accurately depends on exogenous DOX dosage; and on the basis of H9-iOE-NKX2.2, the H9-iOE-NKX2.2 is cultured for 12 days by using a specific nerve induction culture medium, and meanwhile, the expression of NKX2.2 is induced at a low level in the first 6 days. According to the invention, the functional human Floor Plate cells secreting SHH can be rapidly obtained, and the human Floor Plate cells obtained by differentiation can be applied to in-vitro research of human neural circuit constitution, treatment of various brain development disorder diseases caused by FP cell abnormality and expansion of in-vitro brain cell differentiation methods.

Description

technical field [0001] The present invention relates to the fields of gene editing means and human embryonic stem cells, specifically, a method for inducing gene-edited human embryonic stem cells to differentiate into central nervous system basal plate (Floor Plate, FP) cells in vitro, and corresponding applications. Background technique [0002] Human basal plate FP cells arise from the dorsal ectoderm, near the notochord [1，2] , after maturity, the dorsoventral division in the human brain is located in the most ventral area, and the anterior-posterior axis distributes through the whole brain, from the spinal cord through the midbrain, and extends to the telencephalon facing the frontal neuroperineural cortex. FP is the precursor cell of midbrain dopaminergic neuron differentiation, and in vitro differentiation of FP cells is also used as an effective means to further differentiate dopaminergic neuron and treat Parkinson's syndrome. As the signal center of the nervous syst...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/12C12N5/079
CPCC12N5/0618C07K14/47C12N2506/02Y02A50/30
Inventor 陆建峰芦心雨曹立宁
Owner SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com