Method for obtaining human Floor Plate cells and application of human Floor Plate cells
A basal plate and human embryonic stem cell technology, applied in the field of central nervous system basal plate cells, can solve the problems of high price, unstable FP efficiency, and unstable concentration, and achieve the effect of improving differentiation stability and efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1 Culture of human embryonic stem cell line H9
[0060] The human embryonic stem cell line H9 (H9 based on MTA number: WiCell Agreement No: 21-W0349) was cultured in Matrigel-coated well plates, cultured in E8 medium, and the medium was replaced every day, and cultured to 80% density for about 7 days. Perform 1:12 passage expansion operation or cryopreservation operation.
[0061] Both subculture and cryopreservation need to use DPBS to wash off excess medium, then add digestive enzyme ReleSR to the well, absorb the digestive solution within 1 minute, digest at room temperature for 7 minutes, add an appropriate amount of E8 to stop digestion, and tap the well plate to remove the cells. Pat it off and get about 0.1cm 2 Large or small cell clumps, passage to a new well plate at 1:12, or add the prepared cryopreservation solution (E8:FBS:DMSO=7:2:1) to collect cells into cryopreservation tubes Transfer to a -80°C refrigerator for pre-cooling for 24 hours, and ...
Embodiment 2
[0062] Example 2 Construction and sequencing verification of inducible overexpression vector AAVS1-TRE3G-NKX2.2
[0063] AAVS1-TRE3G-NKX2.2 plasmid construction: The CDS region of NKX2-2 (NCBI Reference Sequence: NP_002500.1) was obtained from pENTER-NKX2.2 (vigene bioscienceNM_002509) by PCR method, and the upstream and downstream primers were NKX2.2-CDS -Forward (GCACCAAAATCAACGGGACTTTCC, SEQ ID NO 1) and NKX2.2-CDS-Reverse (CCTCTACAAATGTGGTATGGC, SEQ ID NO 2), use 2×fast pfu mix (Novoprotein) for PCR, annealing temperature is 60°C, 50 μL PCR reaction system reaction End purification using a purification kit and concentration measurement using a microplate reader. Homologous recombination Use a homologous recombination kit to carry out homologous recombination according to the concentration of the purified vector after enzyme digestion and the concentration of the insert fragment at 1:3. After purification, transform into competent E. coli, extract the plasmid with a small e...
Embodiment 3
[0065] Example 3 Plasmid transfection and clone identification of human embryonic stem cell line H9 cells
[0066]Human embryonic stem cells H9 cell line was transfected by electroporation. Prepare cells to be electroporated first: use E8 medium to culture H9 cells on Matrigel-coated dishes, and culture the cells at a density of about 80%, and add Y-27632 (Sigma-Aldrich #688001) one day before electroporation.
[0067] The human embryonic stem cell line H9 after electroporation was cultured on mouse embryonic fibroblasts (MEFs) treated with X-rays, and the MEF cells should be revived one day in advance to a gelatin-coated culture plate, using DMEM high Culture medium supplemented with 10% FBS and 1% PS in sugar for 24 hours. On the day of electroporation, wash the MEF prepared 24 hours ago with DPBS, and then add hESM containing Y-27632 and 50ng / mL growth factor bFGF to each well of the MEF culture plate. Treat the H9 to be electroporated, first wash away the residual medium...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


