Method and kit for jointly detecting exosome by using multiple markers
A combined detection and exosome technology, used in biological testing, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the problems of sensor probe interference, difficulty in distinguishing normal and tumor patients, etc. Simple, high sensitivity, and the effect of improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The kit for joint detection of exosomes using multiple markers in this embodiment includes probe sequences as shown in Table 1.
[0036] Table 1. Probe sequences used for combined detection of multiple markers on the surface of Exo
[0037]
[0038] Depend on figure 1 It can be seen that the proximity probes P1 and P2 are composed of three regions: the I region is the recognition part, and the I regions of P1 and P2 are the EGFR aptamers (Apt EGFR ) and EpCAM aptamers (Apt EpCAM ); the II region is a spacer sequence, that is, the P1 spacer sequence and the P2 spacer sequence, which can reduce the steric hindrance effect when combined with the signal probe; the III region is a tail sequence marked with FAM. Region I of P1 contains the sequence tgccgtttcttctctttcgctttttttgcttttgagcat, region II contains the sequence tttatgtcatgatct, and region III contains the sequence tttttttttt. Region I of P2 contains the sequence cactacagaggttgcgtctgtcccacgttgtcatggggggttggcctg,...
Embodiment 2
[0050] Detection of exosomes in complex biological samples
[0051] Fetal bovine serum was ultracentrifuged for 2.5h (4°C, 100,000g) to remove Exo. A known concentration of Exo derived from A549 cells was added to 10%, 20% and 50% of exosome-free fetal bovine serum, respectively, and detected according to the method constructed in step 4 of Example 1. The result is as Figure 4 shown. Depend on Figure 4 It can be seen that the I produced by Exo in 10%, 20% and 50% UC-FBS was analyzed by independent samples t-test 580 / I 522 There was no significant difference from the results in buffer (P>0.05). It shows that the method can avoid the influence of complex biological sample matrix on the detection results by using the ratiometric signal for self-calibration, and has good anti-interference ability.
Embodiment 3
[0053] clinical applicability test
[0054] The method was used to detect Exo in the plasma of non-small cell lung cancer patients (15 cases) and healthy volunteers (15 cases). Plasma samples from patients with non-small cell lung cancer (15 cases) and healthy volunteers (15 cases) were obtained from the First Affiliated Hospital of Zhengzhou University, all of which were remaining samples from clinical testing. The experiment has been approved by the Life Science Ethics Review Committee of Zhengzhou University, and was carried out in accordance with relevant regulations. The collected plasma sample was centrifuged at 3000 rpm for 5 min, the supernatant was filtered through a 0.22 μm filter membrane, diluted 5 times with reaction buffer, and detected by the method constructed in step 4 in Example 1. The result is as Figure 5shown. Independent sample t-test was performed on the detection results, and it was found that the co-expression of CD63 / EGFR / EpCAM Exo in the plasma o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More