Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Breeding method for obtaining XX/XY sex-determined pseudo male fish parents on large scale and application thereof

A technology of false male fish and sex, which is applied in the field of breeding of pseudo male fish parents, can solve problems such as unstable sex development of broodstock, water pollution, fish residues, etc., to achieve quantitative expansion and simple screening, improve production efficiency, The effect of lowering the level

Active Publication Date: 2021-12-21
INST OF AQUATIC LIFE ACAD SINICA
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the above methods, the use of hormone-related substances often causes water pollution, fish residues, drug-induced sex development instability of broodstock, and is limited to large-scale applications. Therefore, it is difficult to use in the production practice of expansion are promoted, which presents a barrier to parthenogenesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Breeding method for obtaining XX/XY sex-determined pseudo male fish parents on large scale and application thereof
  • Breeding method for obtaining XX/XY sex-determined pseudo male fish parents on large scale and application thereof
  • Breeding method for obtaining XX/XY sex-determined pseudo male fish parents on large scale and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1 of the present invention provides a breeding method for large-scale obtaining XX / XY sex-determined pseudo-male parents, comprising the following steps:

[0067] S1, obtaining the cyp17a1 gene edited injection mixture, and injecting it into the embryo of the fish, using the gene editing technology to knock out the cyp17a1 gene in the fish, and obtaining the F0 generation;

[0068] S11, by using the online tool http: / / zifit.partners.org / ZiFiT / Disclaimer.aspx to find the cyp17a1 gene editing target site, the gene target site is located on exon 1 of the cyp17a1 gene, divided into the first target site and The second target site, the sequences of the aforementioned two are respectively TGGCTTTTCTGTTCATGCC and CCAAGCCTCCCATCACTCCC (such as SEQ ID NO.1, SEQ ID NO.2 and figure 2 shown in the sequence marked in);

[0069] S12, design corresponding primers according to the fish cyp17a1 gene editing target site (as shown in Table 1, the sequence of the forward prime...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a breeding method for obtaining XX / XY sex-determined pseudo male fish parents on a large scale and application thereof. According to the method, cyp17a1 genes of fishes are specifically cut by utilizing a CRISPR / Cas9 system to obtain effectively mutated F1-generation cyp17a1 heterozygote fishes (cyp17a1 + / -), selfing is carried out, pseudo male fishes of XX sex genetic type cyp17a1 homozygote (cyp17a1- / -XX) are screened out through sex markers, the pseudo male fishes are hybridized with heterozygote female fishes (cyp17a1 + / -XX), and the quantity ratio of the obtained pseudo male fishes (cyp17a1- / -XX) in a group is as high as 50%, so that the effect of expanding the number of parent population of the pseudo-male fish on a large scale is achieved. According to the breeding method provided by the invention, the number propagation and simple screening of the pseudo male fish population are effectively realized, the production efficiency of sex determination control breeding is improved, and more backup parents are provided for subsequently obtaining all-female fishes. The method has strong applicability and wide adaptability and expansibility in aquaculture of economic fishes, and the application range of the method in the field of fish sex determination breeding is greatly expanded.

Description

technical field [0001] The present invention relates to the technical field of gene editing, and also to the technical field of fish sex control breeding, in particular to a breeding method for obtaining XX / XY sex-determined pseudo male fish parents on a large scale and its application. Background technique [0002] The development of aquaculture has become an indispensable part of the world, and the production of freshwater fish in my country is increasing day by day. Sexual differences in individual size, external shape, and color characteristics widely exist in aquatic fishes, which is called sexual dimorphism or sexual dimorphism of fish. Many fishes show significant sexual dimorphism in important production traits such as individual size, for example, females of the Yellow River carp grow significantly faster than males, and the economic value of this production trait is closely related to sex. Therefore, the development of single-sex breeding technology for fish is of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89C12N15/55C12N15/53A01K67/027
CPCC12N15/89C12N9/22C12N9/0071A01K67/0276A01K2217/075A01K2217/15A01K2227/40A01K2267/02Y02A40/81
Inventor 殷战翟刚舒婷婷娄气永贺江燕姜冬火钱雪桥石闯黄建飞贾景怡
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com