Culture medium for in-vitro large-scale culture of meat seed cells and genetic manipulation method

A cell body and growth medium technology, applied in the field of stem cells and cell culture meat, can solve the problems of cell damage, time-consuming and labor-consuming, slow cell proliferation, etc.

Pending Publication Date: 2021-12-31
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under this culture condition, the phenomenon of contact inhibition will occur during the culture of muscle stem cells, that is, when the cell density reaches a certain level, the cells proliferate slowly and tend to differentiate. It is one of the main limiting factors for the industrialization of cell culture meat

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Culture medium for in-vitro large-scale culture of meat seed cells and genetic manipulation method
  • Culture medium for in-vitro large-scale culture of meat seed cells and genetic manipulation method
  • Culture medium for in-vitro large-scale culture of meat seed cells and genetic manipulation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1 Effects of adding different concentrations of Hippo pathway intermediate enzyme inhibitor XMU-MP-1 on cell proliferation, stemness maintenance and cell differentiation after the cells were inoculated at low and high densities in the expanded culture of porcine muscle stem cells in vitro

[0085] The experiment was divided into 3 groups, namely the control group, the 1μM XMU-MP-1 treatment group, and the 3μM XMU-MP-1 treatment group.

[0086] The specific operation is:

[0087] (1) Prepare the cell growth medium added with Hippo pathway inhibitor, the cell growth medium includes 20vol% fetal bovine serum, 79vol% F10 medium, 1vol% penicillin streptomycin double antibody and 5ng / ml fibroblast growth factor 2;

[0088] In the control group, the solvent dimethyl sulfoxide was added to the above medium.

[0089] 1μM XMU-MP-1 treatment group was added 1μM XMU-MP-1 to the above medium;

[0090] 3μM XMU-MP-1 treatment group was added 3μM XMU-MP-1 to the above medium...

Embodiment 2

[0094] Example 2 Effects of adding different concentrations of YAP activator LPA on cell proliferation, stemness maintenance and cell differentiation after the cells were inoculated at low and high densities in the expanded culture of porcine muscle stem cells in vitro

[0095] The experiment was divided into 3 groups, namely the control group, the 10μM LPA treatment group, and the 25μM LPA treatment group.

[0096] (1) Prepare the cell growth medium added with the Hippo pathway effector activator, the cell growth medium includes 20vol% fetal bovine serum, 79vol% F10 medium, 1vol% penicillin streptomycin double antibody and 5ng / ml adult Fibroblast growth factor 2;

[0097] The control group added 0.1% bovine serum albumin solution to the above medium;

[0098] 10 μM LPA treatment group was added 10 μM LPA to the above medium;

[0099] 25 μM LPA treatment group was added 25 μM LPA to the above medium;

[0100] The above medium was added to a 10 cm cell culture dish precoated...

Embodiment 3

[0103] Example 3 Silence the Hippo pathway intermediate enzyme gene in porcine muscle stem cells by siRNA and shRNA, and detect cell proliferation, stemness maintenance and cell differentiation

[0104] In this experiment, siRNA interference and shRNA knockdown were used to silence the expression of Hippo pathway intermediate enzyme genes MST1, MST2, LATS1 and LATS2 in porcine muscle stem cells. The experiment was divided into seven groups: control group, MST1 siRNA silencing group, LATS1 siRNA silencing group, LATS2 siRNA silencing group, MST1 shRNA silencing group, LATS1 shRNA silencing group, LATS2 shRNA silencing group.

[0105] (1) Design and synthesize the siRNA sequence targeting the mesosome gene: the siRNA sequence of MST1 is: GAGCCACCCAATCCCGTAGGGACTA (SEQ ID NO.1), the siRNA sequence of LATS1 is: CAGTAGTGGTCAGACTGACTTTATG (SEQ ID NO.2), the siRNA sequence of LATS2 The siRNA sequence is: CGGGTGGGACCGGAAAGTGCACTTT (SEQ ID NO.3); the shRNA targeting the mesosome is des...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an improved culture medium for in-vitro amplification culture of meat seed cells and a genetic manipulation method. An activator and an inhibitor targeting a Hippo-YAP pathway are added into the improved culture medium, and proliferation of muscle stem cells can be promoted and stemness gene expression can be maintained under a high-density condition. The genetic manipulation method refers to carrying out genetic manipulations such as knock-down, knock-out and overexpression on key elements of the Hippo-YAP pathway, and proliferation and stemness maintenance of the muscle stem cells under the high-density condition can be promoted. The improved culture medium and the genetic manipulation method are beneficial to in-vitro mass amplification of functional muscle stem cells, and the large-scale requirement of cultured meat production on seed cells is better met.

Description

technical field [0001] The invention belongs to the technical field of stem cells and cell-cultured meat, and in particular relates to an improved medium and a gene manipulation method for solving the problem of contact inhibition in the process of in vitro expansion of cultured meat seed cells. Background technique [0002] With economic growth and changes in the nutritional structure, the global demand for meat products is showing an unprecedented rapid growth trend, and the meat production methods that rely on traditional farming are facing increasingly severe challenges. Cultured meat is a future food production technology developed based on cell engineering, tissue engineering and other technologies. Through the separation and expansion of livestock stem cells, directional myogenic differentiation, food processing and other processes, the green, safe and sustainable meat can be realized Production. Compared with traditional production, the cultured meat production proc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N5/0775C12N15/867C12N15/66C12N15/12C12N15/54
CPCC12N5/0662C07K14/4703C12N15/86C12N9/12C12Y207/11001C12N2501/01C12N2501/115C12N2501/998C12N2500/30C12N2500/46C12N2740/15041C12N2740/15052
Inventor 郭仁朋刘政丁世杰林玲唐长波
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap