Culture medium for in-vitro large-scale culture of meat seed cells and genetic manipulation method
A cell body and growth medium technology, applied in the field of stem cells and cell culture meat, can solve the problems of cell damage, time-consuming and labor-consuming, slow cell proliferation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0084] Example 1 Effects of adding different concentrations of Hippo pathway intermediate enzyme inhibitor XMU-MP-1 on cell proliferation, stemness maintenance and cell differentiation after the cells were inoculated at low and high densities in the expanded culture of porcine muscle stem cells in vitro
[0085] The experiment was divided into 3 groups, namely the control group, the 1μM XMU-MP-1 treatment group, and the 3μM XMU-MP-1 treatment group.
[0086] The specific operation is:
[0087] (1) Prepare the cell growth medium added with Hippo pathway inhibitor, the cell growth medium includes 20vol% fetal bovine serum, 79vol% F10 medium, 1vol% penicillin streptomycin double antibody and 5ng / ml fibroblast growth factor 2;
[0088] In the control group, the solvent dimethyl sulfoxide was added to the above medium.
[0089] 1μM XMU-MP-1 treatment group was added 1μM XMU-MP-1 to the above medium;
[0090] 3μM XMU-MP-1 treatment group was added 3μM XMU-MP-1 to the above medium...
Embodiment 2
[0094] Example 2 Effects of adding different concentrations of YAP activator LPA on cell proliferation, stemness maintenance and cell differentiation after the cells were inoculated at low and high densities in the expanded culture of porcine muscle stem cells in vitro
[0095] The experiment was divided into 3 groups, namely the control group, the 10μM LPA treatment group, and the 25μM LPA treatment group.
[0096] (1) Prepare the cell growth medium added with the Hippo pathway effector activator, the cell growth medium includes 20vol% fetal bovine serum, 79vol% F10 medium, 1vol% penicillin streptomycin double antibody and 5ng / ml adult Fibroblast growth factor 2;
[0097] The control group added 0.1% bovine serum albumin solution to the above medium;
[0098] 10 μM LPA treatment group was added 10 μM LPA to the above medium;
[0099] 25 μM LPA treatment group was added 25 μM LPA to the above medium;
[0100] The above medium was added to a 10 cm cell culture dish precoated...
Embodiment 3
[0103] Example 3 Silence the Hippo pathway intermediate enzyme gene in porcine muscle stem cells by siRNA and shRNA, and detect cell proliferation, stemness maintenance and cell differentiation
[0104] In this experiment, siRNA interference and shRNA knockdown were used to silence the expression of Hippo pathway intermediate enzyme genes MST1, MST2, LATS1 and LATS2 in porcine muscle stem cells. The experiment was divided into seven groups: control group, MST1 siRNA silencing group, LATS1 siRNA silencing group, LATS2 siRNA silencing group, MST1 shRNA silencing group, LATS1 shRNA silencing group, LATS2 shRNA silencing group.
[0105] (1) Design and synthesize the siRNA sequence targeting the mesosome gene: the siRNA sequence of MST1 is: GAGCCACCCAATCCCGTAGGGACTA (SEQ ID NO.1), the siRNA sequence of LATS1 is: CAGTAGTGGTCAGACTGACTTTATG (SEQ ID NO.2), the siRNA sequence of LATS2 The siRNA sequence is: CGGGTGGGACCGGAAAGTGCACTTT (SEQ ID NO.3); the shRNA targeting the mesosome is des...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


