Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of arsenic sulfide to inhibition of angiogenesis, migration and invasion of liver cancer based on inhibition of TRPC6

A technology for inhibiting liver cancer and angiogenesis, applied in the field of medicine, can solve the problem of unclear mechanism of action of arsenic sulfide

Pending Publication Date: 2022-01-04
XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the mechanism of action of arsenic sulfide against liver cancer is still unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of arsenic sulfide to inhibition of angiogenesis, migration and invasion of liver cancer based on inhibition of TRPC6
  • Application of arsenic sulfide to inhibition of angiogenesis, migration and invasion of liver cancer based on inhibition of TRPC6
  • Application of arsenic sulfide to inhibition of angiogenesis, migration and invasion of liver cancer based on inhibition of TRPC6

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1.QRT-PCR experiment

[0051] Primers were synthesized by Sangon Bioengineering Shanghai Co., Ltd.

[0052] Primer sequences used: TRPC6 R: TCTGGAGTGGCTAAACGAGT,

[0053] TRPC6 F: ATGATGAAGATGGGACACGG,

[0054] GAPDH R: atggtggtgaagacgccagta,

[0055] GAPDH F: ggcacagtcaaggctgagaatg

[0056] 1.1 Extraction and concentration determination of total RNA

[0057] (1) Items required for the experiment: DEPC water, RNase-free pipette tips, enzyme-free centrifuge tubes, TRIzol, chloroform, isopropanol, and absolute ethanol.

[0058] (2) RNA extraction: Take the cells inoculated in a 6-well plate, pour off the medium, wash 3 times with PBS, directly inject 1ml TRIzol into the 6-well plate, and repeatedly pump and beat evenly.

[0059] (3) After homogenization, transfer the liquid into an RNase-free centrifuge tube, place 5 molecules at room temperature, add 200ul chloroform to the centrifuge tube, shake vigorously for 15 seconds, place at room temperature for 5 ...

Embodiment 2

[0066] Example 2. Western blot experiment

[0067] 2.1 Items needed for the extraction experiment of total cell protein: 4°C high-speed centrifuge, pipette tip, 1.5ml centrifuge tube, cell scraper, cell lysate, PMSF, protease inhibitor, phosphatase inhibitor, ice.

[0068] (1) The cells in the 6-well plate were gently washed 3 times with pre-cooled PBS, and then all the PBS was aspirated as much as possible, and the cells in the 6-well plate were placed on ice.

[0069] (2) Add 120ul of RIPA Lysis Solution (containing PMSF, protease inhibitors and phosphatase inhibitors) into a 6-well plate, and lyse on ice for 30 minutes.

[0070] (3) Cell scraping from top to bottom, from left to right, repeated scraping the cells several times, and then put the protein in the EP tube.

[0071] (4) Put the EP tube containing the protein into a pre-cooled low-temperature high-speed centrifuge, and centrifuge at 12000 rpm for 10 min at 4°C.

[0072] (5) After centrifugation, transfer the super...

Embodiment 3

[0109] Embodiment 3. Scratch experiment

[0110] Spread the liver cancer cells pretreated for 24 hours on a 6-well plate, and the cell density should grow to about 80%-90% the next day. The second day after inoculation, the old medium was sucked off, and then a 200ul pipette tip was used to draw a straight line in the center of the 6-well plate to form a scratch between the monolayer cells. Gently wash off the exfoliated cells with DMEM, so that there are no exfoliated cells on the scratch. Complete medium was then added. After 24 hours in the incubator, observe and take pictures under an inverted microscope. This experiment was repeated 3 times.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides use of an active constituent, which is characterized in that the active constituent is arsenic sulfide; the use is application to inhibition of angiogenesis, migration and invasion of liver cancer based on inhibition of TRPC6.

Description

technical field [0001] The invention relates to the field of medicine, in particular to the application of arsenic sulfide in inhibiting angiogenesis, migration and invasion of liver cancer based on inhibiting TRPC6. Background technique [0002] Recent studies have found that arsenic sulfide has medicinal value. [0003] However, the mechanism of action of arsenic sulfide against liver cancer is still unclear. Contents of the invention [0004] The present invention aims to overcome the above-mentioned defects, and studies the action mechanism of arsenic sulfide in the medical field from the perspective of mechanism, so as to provide a theoretical basis for the manufacture and use of medicines. [0005] The invention provides a kind of purposes of active ingredient, it is characterized in that: [0006] The active ingredient above is arsenic sulfide; [0007] The above purposes include at least one of the following purposes: [0008] For the preparation of drugs for i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K33/36A61P35/00A61P35/04
CPCA61K33/36A61P35/00A61P35/04
Inventor 陈思宇陆舒旻蔡宇康婷朱传营
Owner XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com