Check patentability & draft patents in minutes with Patsnap Eureka AI!

Streptococcus thermophilus capable of producing elastic exopolysaccharide and culture method and use thereof

A technology of Streptococcus thermophilus and exopolysaccharide, which is applied to Streptococcus thermophilus producing elastic exopolysaccharide and its culture field, can solve the problems of fermented milk swallowing, poor sensory experience, poor stability and the like, To achieve the effect of promoting growth, enhancing sensory experience, and good sensory experience

Active Publication Date: 2022-01-11
JIANGSU WECARE BIOTECHNOLOGY CO LTD
View PDF18 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the exopolysaccharide produced by Streptococcus thermophilus in the prior art has a relatively high viscosity but poor elasticity. Although the fermented milk prepared is thick, it is relatively unpalatable to swallow, and the sensory experience is not good. The stability in the shelf life not too good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptococcus thermophilus capable of producing elastic exopolysaccharide and culture method and use thereof
  • Streptococcus thermophilus capable of producing elastic exopolysaccharide and culture method and use thereof
  • Streptococcus thermophilus capable of producing elastic exopolysaccharide and culture method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0042] This preparation example provides an exopolysaccharide-producing Streptococcus thermophilus ST81, the isolation and screening method of which is as follows:

[0043] Streak the single colony of kumiss on the M17 plate, pick a single colony and inoculate it into 5 mL of sterilized milk, and observe the texture of the fermented milk.

[0044] Its culture and preservation method is as follows:

[0045] The isolated and screened elastic exopolysaccharide-producing Streptococcus thermophilus was inoculated in M17 medium, and cultured and preserved at pH 7.0 and 37°C.

[0046] The 16S rDNA molecular biology identification was carried out on the Streptococcus thermophilus ST81 obtained from the screening. Pick a single colony, mix it with sterile water, add bacterial universal primers, carry out colony PCR amplification, and determine its gene sequence. Its 16S rDNA base sequence is as follows:

[0047] GGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTAGAAC GCTGAAGAGAGGAGCTTGCTCTT...

Embodiment 1

[0049] This embodiment provides a fermented milk containing elastic exopolysaccharide, the preparation method of which is as follows:

[0050] (1) Streptococcus thermophilus ST81 was activated using M17 medium, and the inoculum size was 1×10 6 CFU / mL, the activation conditions are: pH 7.0, 37°C, 48h.

[0051] (2) Inoculate the Streptococcus thermophilus ST81 activated in step (1) into the M17 medium, and the inoculum size is 1×10 6 CFU / mL, cultured anaerobically at 37°C for 16 hours to obtain bacterial liquid. The bacterial cells were collected by centrifugation at 6000 rpm for 10 min, and resuspended with the same volume of normal saline as the bacterial solution before centrifugation to obtain a seed culture solution.

[0052] (3) Inoculate the seed culture solution obtained in step (2) and skim milk with an inoculation amount of 2%, and anaerobically ferment at 42° C. for 5 hours to obtain fermented milk containing elastic exopolysaccharide.

Embodiment 2

[0054] This embodiment provides a fermented milk containing elastic exopolysaccharide, the preparation method of which is as follows:

[0055] (1) Streptococcus thermophilus ST81 was activated using M17 medium, and the inoculum size was 1×10 6 CFU / mL, the activation conditions are: pH 6.5, 40°C, 60h.

[0056] (2) Inoculate the Streptococcus thermophilus after activation in step (1) into the M17 medium, and the inoculum size is 1 × 10 6 CFU / mL, cultured anaerobically at 39°C for 20 hours to obtain the bacterial liquid. The bacterial cells were collected by centrifugation at 7000 rpm for 10 min, and resuspended with the same volume of normal saline as the bacterial solution before centrifugation to obtain a seed culture solution.

[0057] (3) Inoculate the seed culture solution obtained in step (2) and skim milk with an inoculation amount of 2%, and anaerobically ferment at 38° C. for 7 hours to obtain fermented milk containing elastic exopolysaccharide.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides streptococcus thermophilus capable of producing elastic exopolysaccharide and a culture method and use thereof. The streptococcus thermophilus capable of producing elastic exopolysaccharide is named as a streptococcus thermophilus ST81 strain and deposited in China General Microbiological Culture Collection Center whose address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing on May 11, 2018 and has a deposit number of CGMCC No.15752. The streptococcus thermophilus capable of producing elastic exopolysaccharide is screened for the first time and used for preparing a fermented milk product, endows the product with good elasticity, remarkably improves viscosity of the product, improves texture of the product and stability of the product, and avoids extra addition of stabilizing agents such as pectin and agar. Therefore, the prepared product has good elasticity, is thick but not sticky, free of wire drawing and mouth sticking and has good swallowing feeling and important use value.

Description

technical field [0001] The invention belongs to the technical field of microbial fermentation, and relates to a streptococcus thermophilus producing exopolysaccharide and its cultivation method and application, in particular to a streptococcus thermophilus producing elastic exopolysaccharide and its cultivation method and application. Background technique [0002] Lactic acid bacteria exopolysaccharide (EPS) is a type of carbohydrate compound secreted by lactic acid bacteria outside the cell wall during growth and metabolism. Some of them attach to the microbial cell wall to form capsules, called capsular polysaccharides; some enter the culture medium to form mucus. Known as mucus polysaccharides, it is the product of microbial adaptation to the environment. Most of the exopolysaccharides of Streptococcus thermophilus are heteromorphic polysaccharides with various types and complex structures. The content of exopolysaccharides of Streptococcus thermophilus in fermented milk ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23C9/123C12R1/46
CPCC12N1/20A23C9/1234A23C9/1238A23V2400/123A23V2400/51A23V2400/249Y02A50/30
Inventor 方曙光韩梅马春艳费腾汪欣朱建国
Owner JIANGSU WECARE BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com