SSR marker for detecting bruchid-resistant variety of broad beans and application of SSR marker

A technology for resisting weevil and broad bean, which is applied to the determination/inspection of microbes, DNA/RNA fragments, biochemical equipment and methods, etc., and can solve the problems of low attention, unsequenced genome sequence, and difficulty in resisting weevil varieties, etc. problems, to achieve significant selectivity, low equipment requirements, and great application prospects

Active Publication Date: 2022-02-11
HAINAN UNIVERSITY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the genome of broad bean is too large (about 14Gb), and the attention is not very high, the genome sequence has not been sequenced, and it is difficult to develop molecular markers
At present, there are not many publicly available SSR markers in faba bean, which directly leads to the difficulty of molecular marker-assisted breeding of soybean weed resistance varieties.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SSR marker for detecting bruchid-resistant variety of broad beans and application of SSR marker
  • SSR marker for detecting bruchid-resistant variety of broad beans and application of SSR marker
  • SSR marker for detecting bruchid-resistant variety of broad beans and application of SSR marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1-acquisition of SSR core motif

[0027] Improving the method for extracting broad bean genome DNA, comprising the steps of:

[0028] (1) Take 80 mg of fresh young leaf tissue of broad bean, add 700 μl of DNA extraction solution and 1% PVP, grind thoroughly, and transfer the grinding solution into a corresponding 1.5 mL centrifuge tube; polyvinyl pyrrolidone (PVP for short);

[0029] (2) Place the centrifuge tube in a 65°C water bath for 30 minutes, take it out every 5 minutes and shake gently to mix;

[0030] (3) After the water bath is completed, add 500 μl of phenol / chloroform / isoamyl alcohol (v / v / v is 25:24:1) into the fume hood, mix it upside down, centrifuge at 12000rpm for 10min, and transfer the supernatant to a new centrifuge tube, then add an equal amount of chloroform / isoamyl alcohol (v / v is 24:1), mix up and down;

[0031] (4) Centrifuge at 12000rpm for 10min, take 500μl of the supernatant and transfer it to a new centrifuge tube, add 2 times th...

Embodiment 2

[0040] Embodiment 2-SSR core motif nucleotide information

[0041] Using PacBio third-generation full-length sequencing technology combined with RNA-seq method, the whole genome of broad bean was sequenced, and the sequence of SEQ ID NO.7 was copied to MISA online software (http: / / pgrc.ipk-gatersleben.de / misa / ) , using the default parameters for analysis, it was found that the 48bp-67bp nucleotide sequence at the 5' end contains the SSR core motif of (TC)10, and the nucleotide sequence is shown in SEQ ID NO.7:

[0042] 5’-GTTATTGTCGTGGAGAAAGGAAAACCTCTCCCGCCACGAAAATTCTATTCTCTCTCTCTCTCTCTCTCTGTAGTAGCCATATACACAGCTAGCTTCGCGTCACAATCTCACTCTCATCAACTCTTCAAACTAATGGCTGCAACTCTTCAAACTCTGCGACTTCCTTTTCATCCATCTATCACACCCCTAAATTCATATCCTTTCCCAACCTCTACCGTCCATTACTCCCCCAAATCAAGCACCTTCAAGGGTTCATCTGTCGCCACCCGCAACAAACCAGTACCTTCTTCCAAAGCTTCCAATTCGCAGTACAGTCCCACTGTTACCGAAAATCTCGCTGACATTAGCATTTTCTCGGCCGCCGGTGAGCCCGTCATGTTCAAAGATCTTTGGGACCAAGAACAGGAAAAGCCCTGATCTTTATCCATTTCTTATCTGTTTTGGGCACAACCATTTTGACCTAA...

Embodiment 3

[0043] Example 3 - Using SSR markers to assist in the identification of broad bean varieties resistant to bean weevil

[0044] Step 1, primer design: According to the nucleotide sequence SEQ ID NO.7 of the specific faba bean genome containing SSR core motif (TC) 10, 3 pairs of SSR primers were designed with Primer 3 software, the sequence is:

[0045] SEQ ID NO.1: AGAAAGGAAAACCTCCCG;

[0046] SEQ ID NO. 2: GTGCTTGATTTGGGGGAGTA. (first pair of primers)

[0047] SEQ ID NO.3: AGAAAGGAAAACCTCCCG;

[0048] SEQ ID NO. 4: GAGTGAGATTGTGACGCGAA. (Second pair of primers)

[0049] SEQ ID NO.5: AGAAAGGAAAACCTCCCG;

[0050] SEQ ID NO. 6: AAGGTACTGGTTTGTTGCGG. (third pair of primers)

[0051] Step 2, PCR amplification: PCR conditions were explored.

[0052] The initial annealing temperature of the primer was obtained by lowering the Tm value given in the primer synthesis sheet by 3°C. Using part of the broad bean genomic DNA to be tested as a template, the selected DNA template was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SSR marker for detecting a bruchid-resistant variety of broad beans and application of the SSR marker. According to the invention, a PacBio three-generation full-length sequencing technology is combined with an RNA-seq method to carry out whole genome sequencing onbroad bean varieties, software MISA is combined to search Unigene of a transcriptome to obtain a specific broad bean genome sequence containing an SSR core motif, primers are designed according to the SSR core motif, and are used for amplifying an SSR marker, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 2; the SSR marker primer pair is used for amplifying a broad bean genome template, a PCR amplification product is subjected to polyacrylamide gel electrophoresis, the banding pattern of the PCR product is detected, and the broad bean material for identifying and detecting is the bruchid-resistant material; and the method for detecting the bruchid resistance of broad beans is reliable, simple, convenient and practical, and has an important application prospect in broad bean germplasm resource identification and molecular marker-assisted breeding selection.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an SSR marker for detecting broad bean varieties resistant to weeds and its application. Background technique [0002] Broad bean (Vicia Faba L.), an annual herb plant, also known as broad bean, Luo Han bean, etc. According to the Song "Taiping Yulan", broad beans were introduced to the Central Plains from the Western Regions by Zhang Qian, an outstanding traveler and diplomat in the Western Han Dynasty. Broad beans are widely planted in my country and have been an important food resource since ancient times, as well as an important export resource. Broad bean is rich in nutritional value, contains 8 kinds of essential amino acids, and has a carbohydrate content of 47% to 60%. It is a dual-purpose crop for food, vegetables, feed, and green manure. It occupies an important position. [0003] Vicia faba is a supplementary quarantine pest in agriculture in my country, and is an impor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2565/125
Inventor沙爱华陈银华孙虎公丹朱秀秀蒋浩中向艳涛魏正欣
OwnerHAINAN UNIVERSITY