Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of miR-519e-5p as target spot for detecting or treating papillary thyroid carcinoma distant metastasis

A technology of mir-519e-5p, papillary carcinoma, which can be applied in medical preparations containing active ingredients, determination/inspection of microorganisms, organic active ingredients, etc., and can solve problems such as no reports related to thyroid cancer.

Active Publication Date: 2022-02-18
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] miR-519e-5p (MIMAT0002828) is transcribed from human chromosome 19, and studies have found that it is associated with acute myocardial infarction and some adverse events during pregnancy (such as preeclampsia, premature rupture of membranes, spontaneous premature birth, etc.), There are reports about the relationship between miR-519e-5p and thyroid cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-519e-5p as target spot for detecting or treating papillary thyroid carcinoma distant metastasis
  • Application of miR-519e-5p as target spot for detecting or treating papillary thyroid carcinoma distant metastasis
  • Application of miR-519e-5p as target spot for detecting or treating papillary thyroid carcinoma distant metastasis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: kit of the present invention

[0030] In this embodiment, the PCR detection kit is taken as an example for introduction.

[0031] 1. Composition of the kit

[0032] 1.1 Reverse transcription reagents

[0033] (1) MicroRNA Stem-loop reverse transcription primer (referred to as "stem-loop primer")

[0034] The sequence (SEQ ID NO.1) is:

[0035] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAAAGT.

[0036] (2) Other conventional reagents required for reverse transcription

[0037] Including dNTP, 5×buffer, M-MLV reverse transcriptase; it can be a conventional reverse transcription reagent in the field.

[0038] 1.2 Real-time fluorescent quantitative PCR reagents

[0039] (1) Quantitative PCR primers

[0040] The sequences are:

[0041] Forward primer (SEQ ID NO.2): 5'-GCGCTTCTCCAAAAGGGAGC-3';

[0042] Reverse primer (SEQ ID NO.3): 5'-GTGCAGGGTCCGAGGT-3'.

[0043] (2) Real-time fluorescent quantitative PCR master mix

[0044] TB Green Premix Ex Taq ...

experiment example 1

[0073] Experimental Example 1: Correlation between exosomal miR-519e-5p and distant metastasis of papillary thyroid carcinoma

[0074] PTC plasma exosomes were extracted from the plasma samples of 27 patients with distant metastasis (M1 group) and 81 patients with non-distant metastasis (M0 group) using the exosome isolation kit ExoQuick-TCTM. The ExoReasySerum / Plasma Maxi Kit kit is used to extract exosomal miRNAs. Real-time fluorescence quantitative PCR was used to detect the expression of some miRNAs, and cel-39-3p was used as an external reference.

[0075] The detected exosomal miRNAs information is shown in Table 3.

[0076] Table 3 miRNA information

[0077]

[0078] The primers for detecting miR-519e-5p are shown in Example 1, and the primers for detecting other miRNAs in Table 3 are shown in Table 4.

[0079] Table 4 Related Primers

[0080]

[0081]

[0082]

[0083] Relative quantitative results showed that miR-519e-5p was significantly different bet...

experiment example 2

[0085] Experimental Example 2: miR-519e-5p inhibits the migration of PTC cell lines

[0086] In this experiment example, two thyroid papillary carcinoma cell lines TPC-1 (BRAF wild type) and K1 (BRAF mutant type) were transfected with miR-519e-5p mimics or miR-519e-5p inhibitor to detect the expression level. Scar test, transwell test, and three-dimensional sphere formation were used to detect its effects on PTC migration, invasion and cell stemness.

[0087] miRNA mimics are artificial mimics of miRNAs that increase miRNA levels in vivo or in cells. In this embodiment, the sequence of miR-519e-5p mimics is: 5'-UUCUCCAAAAGGGAGCACUUUC-3' (SEQ ID NO.25)

[0088] miRNA inhibitor is an inhibitor of miRNA, which can reduce the level of miRNA in vivo or in cells. In this embodiment, the sequence of miR-519e-5p inhibitor is: 5'-GAAAGUGCUCCCUUUUGGAGAA-3' (SEQ ID NO.26).

[0089] The result is as follows:

[0090] image 3 is the expression level of miR-519e-5p in different cells,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses application of miR-519e-5p as a target spot for detecting or treating papillary thyroid carcinoma distant metastasis, and belongs to the field of cancer detection and treatment. The technical scheme of the invention mainly comprises application of a reagent for detecting exosome miR-519e-5p in preparation of a papillary thyroid carcinoma remote metastasis detection kit, and application of an artificial simulant of miR-519e-5p or miR-519e-5 in preparation of a medicine for inhibiting papillary thyroid carcinoma metastasis. According to the kit, the detection process can be simplified, and the pain of a patient is relieved; the medicine can remarkably inhibit mobility, invasiveness and dryness of thyroid cancer cells, and has great application potential.

Description

technical field [0001] The present invention is in the field of cancer detection and treatment. Background technique [0002] In recent years, global data show that the incidence of thyroid cancer has shown a rapid increase, which is mainly attributed to the explosive growth of papillary thyroid carcinoma (papillary thyroid carcinoma, PTC) pathological types. Although the prognosis of PTC is good, its 10-year survival rate can be as high as 90%, but once distant organ metastasis such as lung, bone, brain, and liver occurs (distant metastasis rate is 6-20%), the survival rate of the patient drops significantly, and the 10-year The highest survival rate was only 51.2%. How to effectively control and treat distant metastasis of PTC is an urgent problem to be solved in thyroid surgery. [0003] Exosomes are vesicle-like bodies with a uniform size of about 40-160 nm in diameter secreted by cells, which can specifically carry various biologically active molecules, including lipi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886A61K31/7105A61K31/711A61P35/04
CPCC12Q1/6886A61K31/7105A61K31/711A61P35/04C12Q2600/158C12Q2600/178Y02A50/30
Inventor 雷建勇李根棚陈文杰李志辉朱精强魏涛
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More