Supercharge Your Innovation With Domain-Expert AI Agents!

Newcastle disease virus gene VI type vaccine strain and application thereof

A technology of Newcastle disease virus and vaccine strains, applied in vaccines, viruses, antiviral agents, etc., can solve the problems of immunogenicity affected by maternal antibodies, short duration of immunity, residual virulence, etc., to reduce toxicity Strong strength, good immunogenicity, and good immune effect

Pending Publication Date: 2022-03-11
YEBIO BIOENG OF QINGDAO
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, various problems are often exposed during the use of isolated natural attenuated strains, including a large stress response after immunization, residual virulence, short duration of immunity, and immunogenicity affected by maternal antibodies or immunogenicity. Weakness, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Newcastle disease virus gene VI type vaccine strain and application thereof
  • Newcastle disease virus gene VI type vaccine strain and application thereof
  • Newcastle disease virus gene VI type vaccine strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Screening of Gene Type VI NDV Wild Strain

[0032] A suspected strain of Newcastle disease virus was isolated from pigeons with clinical disease, and the allantoic fluid was collected after inoculating chicken embryos, and the titer of HA was determined. Take 200ul virus allantoic fluid, extract RNA according to the instruction of OMEGA company RNA extraction kit, and reverse transcribe. Partial fragments of the F gene were amplified by PCR and sequenced to obtain fragments of the F gene, and a gene evolution tree was drawn. The upstream primers used for amplification: NDV F-F: ATGGGCTCCAAACCTTCTACCAG; downstream primers: NDV F-R: AAACTGCTGCATCTTCCCAACCG, the size of the amplified fragment is 555 bp. The sequence between 47nt-420nt of the F gene was taken to draw a gene phylogenetic tree, and the genotype of Newcastle disease virus was analyzed.

[0033] The results showed that the virus isolated from the pigeons was Newcastle disease virus. After inoculati...

Embodiment 2

[0034] Example 2 Determination of the full-length sequence of the F gene of gene type Ⅵ NDV YB17-Ⅵ strain

[0035] In order to obtain the full-length accurate sequence of the F gene of YB17-Ⅵ strain, it will be used for the construction of chimeric virus in the next step. Two pairs of primers were designed to determine the sequences of the F gene and its upstream and downstream genes respectively. The primer sequences are shown in the table below:

[0036] Table 1: Primers used to amplify the full-length sequence of the F gene

[0037]

[0038] The results showed that the corresponding DNA bands were amplified respectively, and the full-length gene sequence of the F gene was obtained after splicing, and its coding nucleotide sequence was SEQ ID NO:2.

Embodiment 3

[0039] Example 3 Construction of Gene VI Type Newcastle Disease Virus Attenuated Strain

[0040] Through reverse genetics technology, four recombinant viruses were constructed with the NDV-Ⅶ strain with the preservation number CCTCC NO: V201968 as the parent strain, among which, the HN protein (SEQ ID NO: 3) gene was synthesized in different combinations. Point mutations, including E347K+Q353R+Y304H+D342N, E347K, E347K+Q353R, and Y304H+D342N.

[0041] According to the immune effect of the gene recombinant strain of NDV-Ⅶ strain, the mutated NDV-Ⅶ strain was used as the backbone to construct a gene type Ⅵ Newcastle disease virus recombinant strain, in which the F of the mutated NDV-Ⅶ strain was The gene was replaced with the corresponding F gene of the YB17-Ⅵ strain, and the F gene of the YB17-Ⅵ strain was subjected to a weakening mutation, that is, the amino acid encoded by the basic amino acid cleavage site was 112 R-R-Q-K-R-F 117 mutate into 112 G-R-Q-G-R-L 117 .

[004...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Newcastle disease virus gene type VI vaccine strain which is constructed by carrying out attenuated mutation on an F gene of a pigeon-derived gene type VI Newcastle disease virus, replacing the F gene of a Newcastle disease virus strain with the preservation number of CCTCC NO: V201968 and then carrying out genetic rescue. The amino acids at the 340 site, the 342 site, the 347 site and the 353 site of the HN protein of the Newcastle disease virus strain with the preservation number of CCTCC NO: V201968 are mutated into histidine, asparagine, lysine and arginine respectively. The invention also provides an application of the Newcastle disease virus gene VI type attenuated strain NDV-VIb in preparation of vaccines. The skeleton virus of the constructed gene VI type Newcastle disease virus attenuated strain comes from the modified gene VII type Newcastle disease virus attenuated strain, is safe and reliable, and reduces the risk of virulence reversion; the constructed gene VI type recombinant Newcastle disease virus attenuated strain is mainly used for preventing and controlling the Newcastle disease virus of pigeons, and the F gene is derived from host pigeons and has better immunogenicity than the gene VI type Newcastle disease virus strain derived from chicken.

Description

technical field [0001] The invention belongs to the technical field of veterinary biological products, and in particular relates to a Newcastle disease virus gene type VI vaccine strain and its application. [0002] technical background [0003] Newcastle disease is an acute highly contagious infectious disease of poultry caused by Newcastle disease virus, which can cause the disease of chickens, pigeons, geese, wild birds and other animals. Since Newcastle disease was first discovered in Indonesia in 1926, it has spread rapidly and become popular in many countries and regions in the world. It has caused great harm to the poultry industry. It is a Class A disease that must be reported as required by the World Organization for Animal Health. A class of animal diseases. [0004] Liu Hualei et al. found that the prevailing Newcastle disease virus in my country is dominated by genotypes VII and VI through continuous monitoring of the epidemic strains of Newcastle disease. Among ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N7/04C12N15/85A61K39/17A61P31/14C12R1/93
CPCC12N7/00C12N15/85A61K39/12A61P31/14C12N2760/18121C12N2760/18162C12N2760/18134A61K2039/552A61K2039/5254
Inventor 孙化露楚电峰于晓璐李振侯玉超孙鹏范根成杜元钊
Owner YEBIO BIOENG OF QINGDAO
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More