Newcastle disease virus gene VI type vaccine strain and application thereof
A technology of Newcastle disease virus and vaccine strains, applied in vaccines, viruses, antiviral agents, etc., can solve the problems of immunogenicity affected by maternal antibodies, short duration of immunity, residual virulence, etc., to reduce toxicity Strong strength, good immunogenicity, and good immune effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Screening of Gene Type VI NDV Wild Strain
[0032] A suspected strain of Newcastle disease virus was isolated from pigeons with clinical disease, and the allantoic fluid was collected after inoculating chicken embryos, and the titer of HA was determined. Take 200ul virus allantoic fluid, extract RNA according to the instruction of OMEGA company RNA extraction kit, and reverse transcribe. Partial fragments of the F gene were amplified by PCR and sequenced to obtain fragments of the F gene, and a gene evolution tree was drawn. The upstream primers used for amplification: NDV F-F: ATGGGCTCCAAACCTTCTACCAG; downstream primers: NDV F-R: AAACTGCTGCATCTTCCCAACCG, the size of the amplified fragment is 555 bp. The sequence between 47nt-420nt of the F gene was taken to draw a gene phylogenetic tree, and the genotype of Newcastle disease virus was analyzed.
[0033] The results showed that the virus isolated from the pigeons was Newcastle disease virus. After inoculati...
Embodiment 2
[0034] Example 2 Determination of the full-length sequence of the F gene of gene type Ⅵ NDV YB17-Ⅵ strain
[0035] In order to obtain the full-length accurate sequence of the F gene of YB17-Ⅵ strain, it will be used for the construction of chimeric virus in the next step. Two pairs of primers were designed to determine the sequences of the F gene and its upstream and downstream genes respectively. The primer sequences are shown in the table below:
[0036] Table 1: Primers used to amplify the full-length sequence of the F gene
[0037]
[0038] The results showed that the corresponding DNA bands were amplified respectively, and the full-length gene sequence of the F gene was obtained after splicing, and its coding nucleotide sequence was SEQ ID NO:2.
Embodiment 3
[0039] Example 3 Construction of Gene VI Type Newcastle Disease Virus Attenuated Strain
[0040] Through reverse genetics technology, four recombinant viruses were constructed with the NDV-Ⅶ strain with the preservation number CCTCC NO: V201968 as the parent strain, among which, the HN protein (SEQ ID NO: 3) gene was synthesized in different combinations. Point mutations, including E347K+Q353R+Y304H+D342N, E347K, E347K+Q353R, and Y304H+D342N.
[0041] According to the immune effect of the gene recombinant strain of NDV-Ⅶ strain, the mutated NDV-Ⅶ strain was used as the backbone to construct a gene type Ⅵ Newcastle disease virus recombinant strain, in which the F of the mutated NDV-Ⅶ strain was The gene was replaced with the corresponding F gene of the YB17-Ⅵ strain, and the F gene of the YB17-Ⅵ strain was subjected to a weakening mutation, that is, the amino acid encoded by the basic amino acid cleavage site was 112 R-R-Q-K-R-F 117 mutate into 112 G-R-Q-G-R-L 117 .
[004...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com