Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for central targeted delivery of siRNA based on adipose tissue and application

A fat tissue and central technology, applied in the field of biomedicine, can solve the problems of exosomes that are difficult to meet the clinical needs, the risk is not easy to control, and the cost is high, so as to solve the problems of immunogenicity and toxicity, facilitate large-scale clinical application, and reduce costs and risk effects

Pending Publication Date: 2022-04-01
NANJING DRUM TOWER HOSPITAL
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to allow exosomes to better target the central nervous system, the existing technology modifies exosomes by brain-targeting peptide (rabies virus glycoprotein RVG), but this may increase the immune response
In addition, in the traditional exosome-based siRNA delivery strategy, siRNA needs to be pre-assembled with exosomes in an in vitro culture environment. This method is costly, the process is complicated, and the risk is not easy to control. The obtained exosomes are difficult to meet clinical needs. , which largely limits its large-scale application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for central targeted delivery of siRNA based on adipose tissue and application
  • Method for central targeted delivery of siRNA based on adipose tissue and application
  • Method for central targeted delivery of siRNA based on adipose tissue and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] In vivo targeting center detection and verification of adipose tissue exosomes

[0034] 1. Preparation of rAAV-palm-mCherry adeno-associated virus

[0035] The rAAV-palm-mCherry virus is rAAV-CMV-palm-mCherry-WPRE-hGH pA, constructed by Wuhan Privy Brain Science and Technology Co., Ltd., and the palm-mCherry sequence is as follows:

[0036] AtgctgtgctgtatgagaagaaccaaacagATGGTGAGCAAGGGCGAGGAGGATAACATG GCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCC ACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACC GCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCC CTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACG GCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAA GGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACC ATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGC GAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAA GACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAAC...

Embodiment 2

[0040]Adipose tissue injection with rAAV-siBACE1 adeno-associated virus significantly increased siBACE1 levels in adipose exosomes

[0041] 1. Preparation of rAAV-siBACE1 adeno-associated virus and control virus

[0042] The rAAV-siBACE1 virus is rAAV-U6-shRNA(Bace1)-CMV-mCherry-SV40 pA, and the control virus is rAAV-U6-shRNA(scramble)-CMV-mCherry-SV40 pA, constructed by Wuhan Privy Brain Science and Technology Co., Ltd.

[0043] siBACE1 sequence:

[0044] 5′-GAUGAAUUCCUAUCUUUGUUAAGCUUCCUGUCACUUAACAAGAUAGGAAUUCAUCUGUU-3′

[0045] Control sequence:

[0046] 5′-UUCUCCGAACGUGUCACGUGCUUCCUGUCACACGUGACACGUUCGGAGAA UU-3′

[0047] 2. Ten 8-week-old C57 mice were randomly divided into two groups, and rAAV-siBACE1 adeno-associated virus and its control virus were injected into the visceral fat of the mice respectively (the standard dose of the virus was 5E+12 vg / ml, 2 μl). After 2 weeks, the mice were sacrificed, and the visceral fat of the mice was cultured, exosomes were isolate...

Embodiment 3

[0063] Adipose tissue injection of rAAV-siBACE1 adeno-associated virus targets central delivery of siBACE1

[0064] 1. 5-month-old AAP / PS1 mice (AD mice) were randomly divided into two groups, AD+rAAV-control group (control group) and AD+rAAV-siBACE1 group (siBACE1 group), 5 mice in each group. The visceral fat of each group of mice was injected with the corresponding virus, and the mice were sacrificed 2 weeks later, the brain tissue of the mice was taken, and the hippocampus and cortex were separated to extract RNA and protein. The mRNA level of BACE1 was detected by qRT-PCR, and the expression level of BACE1 protein was detected by Western-blot.

[0065] Figure 6 It is the content detection result figure of mouse hippocampus siBACE1 in Example 3 of the present invention, Figure 7 It is a figure of detection result of siBACE1 mRNA content in Example 3 of the present invention, Figure 8 It is the siBACE1 expression protein detection and content statistical chart in Exa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for central targeting delivery of siRNA based on adipose tissue, which is characterized in that a virus vector loaded with siRNA is injected into adipose tissue of human or model animals, and the virus is adeno-associated virus, lentivirus or adenovirus. The invention further discloses application of the adipose tissue-based central targeted delivery siRNA, and the method is applied to treatment of Alzheimer's disease. The exosome secreted by organs of a host is used as a carrier, the restriction of a blood brain barrier in siRNA targeted delivery is overcome, the siRNA targeting BACE1 is effectively conveyed into neurons, A beta deposition is reduced, cognitive impairment of the Alzheimer's disease is improved, and the problems of immunogenicity and toxicity of a traditional siRNA delivery carrier are solved; the method is flexible and variable, simultaneous delivery of different siRNAs can be realized, a complex in-vitro exosome pre-assembly process is not needed, the cost and the risk are greatly reduced, and large-scale clinical application is facilitated.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a method and application of adipose tissue-based central targeted delivery of siRNA. Background technique [0002] The further aggravation of the aging process is accompanied by a problem that cannot be ignored: the increase in the incidence of diseases related to the central nervous system, such as senile dementia (Alzheimer's disease), Parkinson's, and brain tumors. After cardiovascular disease, cerebrovascular disease and cancer, Alzheimer's disease has become the "fourth killer" of the health of the elderly, and there is currently no effective treatment or drug to reverse the progression of the disease. Central nervous system Due to the existence of the blood-brain barrier, most of the current drugs cannot pass through, which makes the treatment of central nervous system diseases a major challenge. Therefore, the development of efficient and safe central drug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7105A61K47/46A61P25/28
Inventor 毕艳王进
Owner NANJING DRUM TOWER HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com