Method for central targeted delivery of siRNA based on adipose tissue and application
A fat tissue and central technology, applied in the field of biomedicine, can solve the problems of exosomes that are difficult to meet the clinical needs, the risk is not easy to control, and the cost is high, so as to solve the problems of immunogenicity and toxicity, facilitate large-scale clinical application, and reduce costs and risk effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] In vivo targeting center detection and verification of adipose tissue exosomes
[0034] 1. Preparation of rAAV-palm-mCherry adeno-associated virus
[0035] The rAAV-palm-mCherry virus is rAAV-CMV-palm-mCherry-WPRE-hGH pA, constructed by Wuhan Privy Brain Science and Technology Co., Ltd., and the palm-mCherry sequence is as follows:
[0036] AtgctgtgctgtatgagaagaaccaaacagATGGTGAGCAAGGGCGAGGAGGATAACATG GCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCC ACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACC GCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCC CTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACG GCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAA GGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACC ATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGC GAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAA GACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAAC...
Embodiment 2
[0040]Adipose tissue injection with rAAV-siBACE1 adeno-associated virus significantly increased siBACE1 levels in adipose exosomes
[0041] 1. Preparation of rAAV-siBACE1 adeno-associated virus and control virus
[0042] The rAAV-siBACE1 virus is rAAV-U6-shRNA(Bace1)-CMV-mCherry-SV40 pA, and the control virus is rAAV-U6-shRNA(scramble)-CMV-mCherry-SV40 pA, constructed by Wuhan Privy Brain Science and Technology Co., Ltd.
[0043] siBACE1 sequence:
[0044] 5′-GAUGAAUUCCUAUCUUUGUUAAGCUUCCUGUCACUUAACAAGAUAGGAAUUCAUCUGUU-3′
[0045] Control sequence:
[0046] 5′-UUCUCCGAACGUGUCACGUGCUUCCUGUCACACGUGACACGUUCGGAGAA UU-3′
[0047] 2. Ten 8-week-old C57 mice were randomly divided into two groups, and rAAV-siBACE1 adeno-associated virus and its control virus were injected into the visceral fat of the mice respectively (the standard dose of the virus was 5E+12 vg / ml, 2 μl). After 2 weeks, the mice were sacrificed, and the visceral fat of the mice was cultured, exosomes were isolate...
Embodiment 3
[0063] Adipose tissue injection of rAAV-siBACE1 adeno-associated virus targets central delivery of siBACE1
[0064] 1. 5-month-old AAP / PS1 mice (AD mice) were randomly divided into two groups, AD+rAAV-control group (control group) and AD+rAAV-siBACE1 group (siBACE1 group), 5 mice in each group. The visceral fat of each group of mice was injected with the corresponding virus, and the mice were sacrificed 2 weeks later, the brain tissue of the mice was taken, and the hippocampus and cortex were separated to extract RNA and protein. The mRNA level of BACE1 was detected by qRT-PCR, and the expression level of BACE1 protein was detected by Western-blot.
[0065] Figure 6 It is the content detection result figure of mouse hippocampus siBACE1 in Example 3 of the present invention, Figure 7 It is a figure of detection result of siBACE1 mRNA content in Example 3 of the present invention, Figure 8 It is the siBACE1 expression protein detection and content statistical chart in Exa...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap