Early detection of liver cancer based on F12 gene methylation

A methylation and gene technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of unfavorable technical transformation, cumbersome steps, high cost, etc.

Inactive Publication Date: 2022-05-06
HANGZHOU NEW HORIZON HEALTH TECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using next-generation sequencing to trace the origin of cfDNA tissue is cumbersome and costly, which is not conducive to technology transformation, and fluorescent quantitative PCR method can solve the above problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Early detection of liver cancer based on F12 gene methylation
  • Early detection of liver cancer based on F12 gene methylation
  • Early detection of liver cancer based on F12 gene methylation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] Example 1: Comparison of methylation levels of F12 in DNA of different cell lines

[0102] The inventors of the present invention based on the data analysis results of the whole blood methylation chips of paracancerous tissues of different cancer types and healthy people in the TCGA and GEO databases, and screened out liver (paracancerous) tissue-specific hypermethylated F12 as liver tissue-specific Methylation candidate markers. Since the methylation chip mainly detects the average methylation level of a sequence containing several CpG islands in the sample, in order to determine the methylation sites suitable for designing detection primer probes, the inventors used the methylation generation sequencing method to The target CpG sites of the above target genes were verified for methylation level one by one.

[0103] According to the analysis results of the methylation chip, the amplification and sequencing primers of the F12 candidate region were designed. The specifi...

Embodiment 2

[0127] Example 2: Tissue-specific study of F12 methylation

[0128] Since most of the cell lines used in Example 1 are cancer cells, compared with non-cancerous cells, the cancer cells themselves may have undergone abnormal methylation in some regions of the genome. Therefore, in the experimental process of the present invention, 3 pairs of primer-probe combinations were designed for several CpG sites found in the sequence of the F12 gene promoter region for subsequent fluorescent quantitative PCR verification. The objects of verification are tissue DNA samples from different organ sources. Table 4 lists the target regions of the F12 gene selected in the experimental process of the present invention.

[0129] Table 4 The sequence of the target region of F12 gene

[0130]

[0131] The F12 forward primers include:

[0132] SEQ ID NO. 7F12-F1: TTGGTAGAGCGTGGTTTCGG

[0133] SEQ ID NO. 8F12-F2: CGTTTGGTAGGTATATCGGTTG

[0134] SEQ ID NO. 9F12-F3: GGACGTCGGGGTTTTAAGTT

[013...

Embodiment 3F12

[0167] Example 3 Analysis Sensitivity Verification of F12 Methylated Targets

[0168] Plasma contains a small amount of free DNA (cfDNA), which originates from different tissues in the body and is released into the blood through apoptosis, necrosis or extracellular secretion. The concentration of cfDNA in healthy people is about 10ng / ml in the human body, and the cfDNA derived from liver tissue accounts for about 1-2% of the total cfDNA. Since cfDNA has a short half-life (0.5-2h) and is prone to degradation, it is necessary to ensure that the detection limit of F12 methylated targets is less than 1%. The inventors used the following experiments to evaluate the minimum detection limit of the three F12 primer-probe combinations on the F12 positive target in the background of 10 ng of negative template DNA.

[0169] The detection primers and probes for each gene are as follows:

[0170] F12 forward primers include:

[0171] SEQ ID NO. 7F12-F1: TTGGTAGAGCGTGGTTTCGG

[0172] SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid methylation detection method for early screening of liver cancer and a corresponding kit for liver cancer detection. A methylation gene detected by the kit contains an F12 (Coagation factor XII) gene, and a detected sample comprises a tissue sample and a plasma sample.

Description

technical field [0001] The invention relates to a method for detecting liver cancer based on F12 gene methylation, and a corresponding kit for detecting liver cancer, which can be used for screening liver cancer. Background technique [0002] Primary hepatocellular carcinoma (HCC) is a malignant tumor with the fifth incidence and the second death rate in my country. In the past five years, the average annual number of primary liver cancer cases in mainland China was 423,000, accounting for 42.5% of the world. The pathological types of primary liver cancer include hepatocellular carcinoma (HCC), cholangiocarcinoma (ICC) and HCC-ICC mixed liver cancer, among which HCC accounts for 85-90%. Liver cancer seriously threatens the life and health of our people. The five-year overall survival rate of liver cancer in my country is only 14.1%. An important reason is that the early diagnosis rate of liver cancer in our country is low, and more than 70% of the patients are already in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6851C12N15/11
CPCC12Q1/6886C12Q1/6851C12Q2600/154C12Q2600/166C12Q2531/113C12Q2523/125C12Q2545/101C12Q2563/107
Inventor李德强张茜陈卓君黄龙妹吕宁陈一友
OwnerHANGZHOU NEW HORIZON HEALTH TECH CO LTD