Reconstructed butyric acid bacillus methylophilus for synergistically assimilating methanol by utilizing WLP (White Like Prescription) pathway and reducing glycine pathway and application of reconstructed butyric acid bacillus methylophilus

A technology of butyricum methylophilus and serine hydroxymethyl, applied in the field of genetic engineering, can solve the problems of restricting the development and application of strains, not involving genetic engineering transformation, etc., to achieve the improvement of methanol assimilation efficiency and the highest biomass, and increase the methanol Effects of assimilation and butyrate synthesis efficiency

Pending Publication Date: 2022-05-13
NANJING UNIV OF TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The current research mainly focuses on the fermentation conditions and medium screening of Bacillus methylophilus, and does not involve related genetic engineering, etc., which limits the development and application of strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reconstructed butyric acid bacillus methylophilus for synergistically assimilating methanol by utilizing WLP (White Like Prescription) pathway and reducing glycine pathway and application of reconstructed butyric acid bacillus methylophilus
  • Reconstructed butyric acid bacillus methylophilus for synergistically assimilating methanol by utilizing WLP (White Like Prescription) pathway and reducing glycine pathway and application of reconstructed butyric acid bacillus methylophilus
  • Reconstructed butyric acid bacillus methylophilus for synergistically assimilating methanol by utilizing WLP (White Like Prescription) pathway and reducing glycine pathway and application of reconstructed butyric acid bacillus methylophilus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Construction of pXY3-rRGS-thl2-glyA plasmid

[0030] 1. Construction of pXY3-thl2-rRGS plasmid

[0031] Using the existing laboratory plasmid pTrc99a-rGCS (for its construction method, see the publication number CN112920984 A) as a template, the aminomethyltransferase ( GcT ), glycine cleavage system H protein ( GcH ), glycine decarboxylase ( GvP ) coding sequence.

[0032] upstream primer with Bam H I enzyme cutting site, sequence is as shown in SEQ ID No.1:

[0033] CGCGGATCCATGGCACAACAGACTCCTTTG;

[0034] downstream primers with Xba I enzyme cutting site, sequence is as shown in SEQ ID No.2:

[0035] CGCGGATCCTTACTGGTATTCGCTAATCGGTACGC.

[0036] The reaction conditions are: 95°C for 2min, 95°C for 20s, 55°C for 20s, 72°C for 180s, a total of 30 cycles; 72°C for 5min; the obtained sequence was subjected to 1% agarose gel electrophoresis to recover the corresponding fragment; the sequence was compared with the expression The vector pXY3 uses the...

Embodiment 2

[0055] Example 2 Construction and fermentation phenotype of BM / pXY3-rRGS-thl2-glyA strain

[0056] The plasmid pMCljs was heat-shock transformed into Escherichia coli Top10 to obtain the recombinant strain Top10 / pMCljs, and the recombinant strain was prepared into competent cells. For the specific operation method, see the patent publication number: CN 113106047 A.

[0057] The recombinant plasmid pXY3-rRGS-thl2-glyA was transformed into competent Top10 / pMCljs to obtain the recombinant strain Top10 / pMCljs / pXY3-rRGS-thl2-glyA. Inoculate the recombinant strain in 5ml of LB medium containing ampicillin resistance at a final concentration of 50ug / mL and 100ug / mL phatomycin hydrochloride, culture at 37°C for 12 hours and extract the plasmid to obtain the methylated plasmid pXY3-rRGS -thl2-glyA. Finally, the methylated plasmid pXY3-rRGS-thl2-glyA was transformed into Bacillus methylbutyophilus to obtain a reconstituted strain: BM / pXY3-rRGS-thl2-glyA.

[0058] Pick a single colony o...

Embodiment 3

[0059] Example 3 Optimization of fermentation conditions for BM / pXY3-rRGS-thl2-glyA strain

[0060] Pick a single colony of BM / pXY3-rRGS-thl2-glyA on the plate, inoculate it into 2ml YTF medium containing erythromycin with a final concentration of 30ug / mL, and culture it for 12-16h. Transfer all to ampoule and grow to OD 600 For 1-1.2, pour the bacterial solution into a 50ml centrifuge tube, centrifuge at 4000rpm for 10min, discard the supernatant, resuspend with PB medium, and measure OD 600 =0.1 inoculum amount was inoculated into 50ml PB medium, and then 100mM-500mM methanol was added (such as image 3 As shown, the growth of 100mM methanol is the best, while 400mM methanol consumes the most methanol, 200mM methanol has the best butyric acid synthesis ratio, but the difference is weak, so 100mM methanol concentration is the best concentration), 0-60mM carbonic acid sodium hydrogen (as Figure 4 As shown, the growth, methanol consumption and butyric acid synthesis of the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to reconstructed butyric acid bacillus methylophilus for assimilating methanol by utilizing a WLP (White Like Prescription) pathway and a reductive glycine pathway and application thereof. The step of reconstructing the methyl butyric acid bacillus comprises assimilating methanol through a natural WLP way; gene introduced into the reconstructed butyric acid methyl bacillus comprises glycine splitting system aminomethyltransferase (GcvT), glycine splitting system H protein (GcvH), glycine decarboxylase (GcvP) and over-expression endogenous serine hydroxymethyltransferase (glyA) which are derived from escherichia coli. Fermentation verification shows that compared with an original strain, the reconstructed bacillus methylophilus has the advantages that the maximum biomass is increased by 55.26%, the methanol assimilation amount is increased by 34.47%, fermentation conditions for fermentation production and synthesis of butyric acid by the reconstructed strain are optimized, the final maximum biomass is increased by 55.26%, the methanol assimilation amount is increased by 57.14%, and the butyric acid synthesis amount is increased by 77.78%.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a reconstituted butyricum methylophilus which utilizes WLP pathway and reducing glycine pathway to synergistically assimilate methanol and its application. Background technique [0002] Methanol (Methanol, CH 3 OH) is the simplest saturated monohydric alcohol and is one of the important carbon-one compound platforms. With the continuous improvement of fossil fuel exploration and excavation technology, the method of producing methanol has gradually developed from dry distillation to chemical synthesis since the 1950s, including pressurized catalysis of synthesis gas from fossil fuels, direct oxidation of methane, Reduction of carbon dioxide and hydrogen in the atmosphere. A large number of abundant raw materials and production projects have emerged, resulting in the continuous and rapid growth of methanol production capacity. In 2018, the total global pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/53C12N15/54C12N15/60C12P7/52C12R1/145
CPCC12N15/74C12N9/1014C12N9/88C12N9/0016C12N15/52C12P7/52C12Y201/0201C12Y401/01064C12Y201/02001
Inventor王昕王静秦家伦马琛陈可泉
OwnerNANJING UNIV OF TECH