Unlock instant, AI-driven research and patent intelligence for your innovation.

Eimeria poisoning SAG20 antigen subunit vaccine as well as preparation method and application thereof

A technology of Eimeria and SAG20, which is applied in the biological field, can solve the problems of live vaccines such as shedding poison, and achieve the effects of good stability, good activity and high safety

Pending Publication Date: 2022-05-24
FOSHAN STANDARD BIO TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with virulent or attenuated live vaccines, the genetically engineered subunit vaccine of the present invention can not only induce a good antibody response, protect poultry against Eimeria oocyst infection, but also has high safety and good stability, solving the problem of The problem of the risk of spreading the virus in live vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eimeria poisoning SAG20 antigen subunit vaccine as well as preparation method and application thereof
  • Eimeria poisoning SAG20 antigen subunit vaccine as well as preparation method and application thereof
  • Eimeria poisoning SAG20 antigen subunit vaccine as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] This embodiment provides a nucleic acid molecule encoding the SAG20 protein of Eimeria catarrhalis. The nucleic acid molecule is a gene encoding the Eimeria catarrhalis SAG20 protein optimized according to the codon preference of Escherichia coli, and the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.1.

[0055] SEQ ID NO.1:

[0056] ATGCTAAAAATAACACAGGCTGGACAACAAACCCCGAAGTATGCCGCTACCCTGGGTAAAAGCGTAAAATGCCTGAGCGAACTGAATAGCGCGCGTGAAGCTGCGGGTCTGCCGAACTTTACTGAGGCAACCGAGGACAAGAAGCTGACCGATCCGAAAGAGGACCTTGATCAAGACACCGAGTGGAAAAAAGTTTGCACCCATCTGATCCCGACCGAGCAGACCGACCCAGTGGCCGCGGCGTCTGCGGCCAATCCGTTTCAGGACGGCACGTACGCCTTCAAGTCCCTGACCGCGGCTGAACCGAATTGTAAAGAGACAGTGGATCATTGGAAGGCGGCGTTCAAGAACTTCACTGGTTTACCGCCTTCGAAAACCCAAGGTGCAGATTTGTACAAAAACCAGGACAACGTCAGCTTTGTTGCGTTGTACAACCCGTCGAGCGATGCAACCGCAGACTGTCAGGTTGTTACGTGCACCAAGACGACCACCGAAGGCACCGTGCTGCAAAACGATTCCGAACAAAGCCCGGAATATGGCTATGCGTTGATCTGCAAGACGATGCCGTCTGCGTTTAAGGACGATAATGCTGTGCCGTTCACTCAGGACCAGTGGGATAAAATT...

Embodiment 2

[0058] This embodiment provides a recombinant vector, which contains the nucleic acid molecule described in Example 1, and the preparation method of the recombinant vector includes the following steps:

[0059] Synthesize the nucleic acid molecule described in Example 1, insert the nucleic acid molecule between the 5'-NdeI and 3'-HindIII restriction sites of the pET-30a vector, and construct the recombinant plasmid pET-30a-SAG20, the steps are as follows:

[0060] Take out the BL21(DE3) competent cells from the ultra-low temperature refrigerator, put them on ice to melt, add the plasmid pET-30a-SAG20 (100ng), mix well, ice bath for 30min, react at 42℃ for 90s, ice bath for 5min, add 100μL LB culture medium, 37°C, 200rpm shaker for 60min, spread evenly on Kana + On LB plates, culture them upside down at 37°C for 12 hours.

[0061] Perform colony PCR identification: pick a single colony on the culture plate and inoculate it in a new kana + On the LB agar plate, prepare the fol...

Embodiment 3

[0072]This embodiment provides a recombinant protein induced and expressed by the recombinant vector described in Example 2, and the recombinant protein is detected. ), the recombinant protein SAG20 is induced and expressed by the expression vector pET-30a-SAG20 constructed in Example 2. The preparation method of the recombinant protein SAG20 comprises the following steps:

[0073] (1) Induced expression of recombinant protein SAG20

[0074] Pick positive clones and inoculate into 4mL containing 50μg / mL Knan + In the LB medium, 37 ℃, 200rpm shaking culture, when OD 600 Between 0.6 and 0.8, add 0.5mM IPTG to the two test tubes respectively, one of the test tubes was incubated at 15°C for 16 hours, and the other test tube was incubated at 37°C for 4 hours. Detection of protein expression and solubility.

[0075] (2) Preparation of recombinant protein SAG20 samples

[0076] Take 450 μL of culture medium and centrifuge the precipitate, resuspend in 300 μL lysis buffer, and ul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an eimeria necatrix SAG20 antigen subunit vaccine and a preparation method and application thereof.The eimeria necatrix SAG20 antigen subunit vaccine is a subunit vaccine prepared through a genetic engineering method, eimeria necatrix SAG20 protein is used as an antigen, a freund's adjuvant is used as an immunologic adjuvant, and the eimeria necatrix SAG20 antigen subunit vaccine is prepared through the genetic engineering method. The eimeria necatrix SAG20 antigen subunit vaccine disclosed by the invention has good immunogenicity, and has good activity in the aspect of resisting E.necatrix oocyst infection. Compared with a virulent or attenuated live vaccine, the genetic engineering subunit vaccine disclosed by the invention not only can induce a good antibody reaction and protect poultry against infection of eimeria coccidian oocysts, but also is high in safety and good in stability, and solves the problem that the live vaccine has a virus scattering risk.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an Eimeria virulence SAG20 antigen subunit vaccine and a preparation method and application thereof. Background technique [0002] Coccidiosis is caused by different species of Eimeria coccidioides of Apicomplexa, Sporozoa, Coccidia, Eimeria, Eimeriaceae, and Eimeria genus parasitizing chicken intestinal epithelial cells simultaneously or successively. A parasitic protozoan disease caused by chickens causes a large number of intestinal epithelial cells to disintegrate, necrosis, shedding, and intestinal mucosal bleeding, which not only seriously affects the growth and development of chickens, reduces the rate of feed return, but also causes chickens to morbidity and death. Causing huge economic losses to the poultry industry. It is estimated that the annual loss of the global breeding industry due to coccidiosis is about 500 million pounds, and the annual cost of prevent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/30C12N15/70A61K39/012A61P33/02
CPCC07K14/455C12N15/70A61K39/012A61P33/02C12N2800/22A61K2039/552Y02A50/30
Inventor 周德荣谭志坚刘叶萍林瑞庆翁亚彪刘丽丹刘园邝春曼尚志祥
Owner FOSHAN STANDARD BIO TECH