Eimeria poisoning SAG20 antigen subunit vaccine as well as preparation method and application thereof
A technology of Eimeria and SAG20, which is applied in the biological field, can solve the problems of live vaccines such as shedding poison, and achieve the effects of good stability, good activity and high safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] This embodiment provides a nucleic acid molecule encoding the SAG20 protein of Eimeria catarrhalis. The nucleic acid molecule is a gene encoding the Eimeria catarrhalis SAG20 protein optimized according to the codon preference of Escherichia coli, and the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.1.
[0055] SEQ ID NO.1:
[0056] ATGCTAAAAATAACACAGGCTGGACAACAAACCCCGAAGTATGCCGCTACCCTGGGTAAAAGCGTAAAATGCCTGAGCGAACTGAATAGCGCGCGTGAAGCTGCGGGTCTGCCGAACTTTACTGAGGCAACCGAGGACAAGAAGCTGACCGATCCGAAAGAGGACCTTGATCAAGACACCGAGTGGAAAAAAGTTTGCACCCATCTGATCCCGACCGAGCAGACCGACCCAGTGGCCGCGGCGTCTGCGGCCAATCCGTTTCAGGACGGCACGTACGCCTTCAAGTCCCTGACCGCGGCTGAACCGAATTGTAAAGAGACAGTGGATCATTGGAAGGCGGCGTTCAAGAACTTCACTGGTTTACCGCCTTCGAAAACCCAAGGTGCAGATTTGTACAAAAACCAGGACAACGTCAGCTTTGTTGCGTTGTACAACCCGTCGAGCGATGCAACCGCAGACTGTCAGGTTGTTACGTGCACCAAGACGACCACCGAAGGCACCGTGCTGCAAAACGATTCCGAACAAAGCCCGGAATATGGCTATGCGTTGATCTGCAAGACGATGCCGTCTGCGTTTAAGGACGATAATGCTGTGCCGTTCACTCAGGACCAGTGGGATAAAATT...
Embodiment 2
[0058] This embodiment provides a recombinant vector, which contains the nucleic acid molecule described in Example 1, and the preparation method of the recombinant vector includes the following steps:
[0059] Synthesize the nucleic acid molecule described in Example 1, insert the nucleic acid molecule between the 5'-NdeI and 3'-HindIII restriction sites of the pET-30a vector, and construct the recombinant plasmid pET-30a-SAG20, the steps are as follows:
[0060] Take out the BL21(DE3) competent cells from the ultra-low temperature refrigerator, put them on ice to melt, add the plasmid pET-30a-SAG20 (100ng), mix well, ice bath for 30min, react at 42℃ for 90s, ice bath for 5min, add 100μL LB culture medium, 37°C, 200rpm shaker for 60min, spread evenly on Kana + On LB plates, culture them upside down at 37°C for 12 hours.
[0061] Perform colony PCR identification: pick a single colony on the culture plate and inoculate it in a new kana + On the LB agar plate, prepare the fol...
Embodiment 3
[0072]This embodiment provides a recombinant protein induced and expressed by the recombinant vector described in Example 2, and the recombinant protein is detected. ), the recombinant protein SAG20 is induced and expressed by the expression vector pET-30a-SAG20 constructed in Example 2. The preparation method of the recombinant protein SAG20 comprises the following steps:
[0073] (1) Induced expression of recombinant protein SAG20
[0074] Pick positive clones and inoculate into 4mL containing 50μg / mL Knan + In the LB medium, 37 ℃, 200rpm shaking culture, when OD 600 Between 0.6 and 0.8, add 0.5mM IPTG to the two test tubes respectively, one of the test tubes was incubated at 15°C for 16 hours, and the other test tube was incubated at 37°C for 4 hours. Detection of protein expression and solubility.
[0075] (2) Preparation of recombinant protein SAG20 samples
[0076] Take 450 μL of culture medium and centrifuge the precipitate, resuspend in 300 μL lysis buffer, and ul...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


