Protein O-fucosyltransferase OsPOFUT1 coding gene, enzyme thereof, preparation and application
A technology of fucosyl and coding genes, applied in the direction of glycosyltransferase, transferase, application, etc., can solve problems such as seed sterility, abnormal pollen tube extension, catalytic activity and glycobiological function investigation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Cloning of the full-length gene of protein O-fucosyltransferase OsPOFUT1
[0031]The mRNA of rice leaves was extracted by referring to the operation steps of RNA extraction kit (Biomed Bio, Cat. No. RN0112). After analyzing the sequence of protein O-fucosyltransferase in The National Center for Biotechnology Information (NCBI) database, the designed primers are Y-OsPOFUT1-F: GGGGCCGAATTCATGAACATCATACTAGAACT, Y-OsPOFUT1-R: TAAAGCGGCCGCGTGGCATGAGATATTGT, to amplify the encoded protein O- The gene sequence of the mature protein of the fucosyltransferase OsPOFUT1 was amplified by PCR using the RNA-reversed cDNA extracted from rice as a template. PCR reaction conditions were: 94°C for 2 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min, 30 cycles; 72°C for 5 min, 1 cycle. The result is as figure 1 shown. After the PCR product was analyzed by agarose gel electrophoresis, the target fragment was cut into gel and recovered, and after double digestion, it w...
Embodiment 2
[0032] Example 2 Gene sequence analysis of protein O-fucosyltransferase OsPOFUT1
[0033] The results of the sequencing of the products of Example 1 were analyzed using the Basic Local AlignmentSearch Tool (BLAST) in the GenBank database, and the Vector NTI Suite 8.0 software was used for multiple sequence alignment to analyze sequence information.
[0034] The obtained protein O-fucosyltransferase gene (named OsPOFUT1) is 1326 bp long, and its nucleotide sequence is shown in SEQ ID NO 1. OsPOFUT1 encodes 441 amino acids and a stop codon, the amino acid sequence of which is shown in SEQ ID NO 2, the theoretical molecular weight of the protein is 50091.8 Da, and the predicted isoelectric point is 8.7365. OsPOFUT1 is located on rice chromosome 2 (LOC_Os02g07200) and has a potential protein O-fucosyltransferase function, but its activity and properties have not been confirmed.
Embodiment 3
[0035] Example 3 Recombinant expression and purification of OsPOFUT1 gene in Pichia pastoris
[0036] The sequencing results of the product of Example 1 showed that the OsPOFUT1 gene shown in SEQ ID NO. 1 was inserted into pPICZαA, and the insertion direction was correct, which proved that the constructed recombinant plasmid was correct, and the recombinant plasmid was named pPICZαA-OsPOFUT1.
[0037] The pPICZαA-OsPOFUT1 was transformed into Pichia pastoris and recombined into the yeast genome. The recombinant yeast clones were initially screened with the tag antibiotic bleomycin of the vector plasmid pPICZαA, and then the pPICZαA universal primers (5'-AOX: GACTGGTTCCAATTGACAAGC; 3 '-AOX: GCAAATGGCATTCTGACATCC) and OsPOFUT1 clone-specific primers (Y-OsPOFUT1-F: GGGGCCGAATTCATGAACATCATACTAGAACT; Y-OsPOFUT1-R: TAAAGCGGCCGCGTGGCATGAGATATTGT) were screened by yeast genome PCR to verify correct transformants. The result is as figure 2 As shown, the left is the universal primer a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More