Alkali-resistant protein A variants and uses thereof

A protein and alkali-resistant technology, applied in the field of protein A variants, can solve problems such as limited application, low mechanical strength, and inability to tolerate high-concentration NaOH cleaning

Active Publication Date: 2022-06-07
百林科(兰州)新材料有限公司 +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these imported protein A affinity chromatography media are usually expensive, accounting for about 85% of the total cost of chromatography media in the downstream purification process of antibody drugs, and there are various deficiencies that can be improved
For example, the matrix microspheres of MabSelect SuRe are highly cross-linked agarose, which has the advantages of excellent hydrophilicity and good biocompatibility, and is very suitable for the separation and purification of antibody biomacromolecules; but the disadvantages are: first, the structure It is soft and has a wide particle size distribution. In actual use, there are problems such as poor packing repeatability and low mechanical strength. Second, Mabselect Sure is generally cleaned with 0.1M NaOH in biopharmaceuticals, and its alkali resistance performance still has a gap; Third, the dynamic load of MabSelect Sure is >30g / L, and there is still a certain gap in the load required for large-scale high-expression antibody production
However, the glass bead structure has a fatal flaw, that is, it cannot tolerate high-concentration NaOH washing, thus limiting its application in large-scale biological samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alkali-resistant protein A variants and uses thereof
  • Alkali-resistant protein A variants and uses thereof
  • Alkali-resistant protein A variants and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Directional optimization method of alkali-resistant protein A variant

[0043] Aiming at the protein function optimization goals of improving alkali resistance and improving the binding ability with IgG, the present invention obtains the protein A variant with targeted optimization through bioinformatics and convolutional neural network.

[0044] The specific technical solution of the method may include the following steps (see figure 2 ):

[0045] Step 1: Take the E, D, C, B and A domains and Z domain sequences of protein A as the initial sequence for directional optimization, and obtain the crystal structure of the corresponding sequence from the RCSB-PDB database, where the A domain The structure was obtained by homology modeling method.

[0046] Step 2: Cross-align the initial sequences and perform structural overlay clustering analysis on amino acid residues.

[0047] Step 3: According to the results of sequence identity and amino acid residue structu...

Embodiment 2

[0080] Example 2 Expression and purification of candidate protein A variants

[0081] The above-mentioned ten amino acid sequences from T_SEQAA-1 to T_SEQAA-10 and the Z domain sequence were optimized by using the dominant codons of Escherichia coli to obtain the following corresponding DNA coding sequences.

[0082] T-SEQDNA-1 (SEQ ID NO: 11)

[0083] ATTGATAACAAATTTAACGAAGAACAGCAGGCGGCGTTTTATGAAGTGCTGCATATGCCGAACCTGAACGCGGAACAGCGTAACGGCTTTATTCAGAGCCTGAAAGATGATCCGAGCCAGAGCACCAACCTGCTGGCGGAAGCGCAGAAACTGAACGAAGCGCAGGCGCCGAAA

[0084] T_SEQDNA-2 (SEQ ID NO: 12)

[0085] CAGGATAACCAGTTTAACAAAGAACAGCAGAACGCGTTTTATCAGATTCTGCATCTGCCGAACCTGAACGCGGAACAGCGTAACGCGTTTATTCAGAGCCTGCGTCATGATCCGAGCCAGAGCCTGAACCTGCTGGGCGAAGCGCAGAAACTGAACGATAGCCAGGCGCCGAAA

[0086] T_SEQDNA-3 (SEQ ID NO: 13)

[0087] GCGCAGAACAAATTTGATAAAGAACAGCAGAACGCGTTTTATCAGATTCTGCATATGCCGAACCTGACCGCGGATCAGCGTAACGGCTTTATTCAGAGCCTGAAAGATGATCCGAGCCAGAGCGCGAACGTGCTGGCGGAAGCGCAGAAACTGAACGATGCGCAGGCGCCGAAA

[0088] T_SEQDNA...

Embodiment 3

[0109] Example 3 Conjugation of candidate protein A variants and microspheres

[0110] In this example, agarose microspheres with high particle size uniformity and good mechanical strength were used as scaffolds to couple candidate protein A variants (1#, 3# and 10#) with similar affinity to the Z domain.

[0111] The brief coupling procedure is as follows.

[0112] Step 1: Measure 5mL of epoxy-activated microspheres and wash twice with 10mL of 0.1M PB, pH 8.6 buffer;

[0113] Step 2: Add 3 mg of candidate protein A variant per ml of filler;

[0114] Step 3: React at 30℃±1℃ for 1 hour;

[0115]Step 4: Wash the gel with 20ml of water each time, wash twice in total, collect the washing liquid to measure the protein concentration (OD280), and calculate the protein A variant content on the coupling;

[0116] Step 5: Wash the gel with 20ml of water, and then wash it 5 times;

[0117] Step 6: Wash twice with 5ml 20% ethanol;

[0118] Step 7: 3mL of 20% ethanol, stored at 2-8°C....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein A variant, and particularly relates to a protein A variant with high alkali resistance and high IgG binding affinity. The invention also discloses application of the protein A variant.

Description

technical field [0001] The present invention relates to protein A variants, especially protein A variants with high alkali resistance. The present invention also relates to the use of this protein A variant. Background technique [0002] Antibody drugs have developed rapidly in recent years. In 2020, half of the top 10 drugs by global sales are antibody drugs. The purification steps in the antibody drug production process usually employ the classical three-step or two-step chromatography. Staphylococcus aureus protein A is a bacterial protein discovered in the 1970s that can bind to the Fc end of multi-species antibodies. , A more widely used affinity ligand. The study found that the unique and specific adsorption ability of multiple regions on the protein A ligand to the Fc segment of the antibody can be used for the specific capture of the antibody. Most of the impurities in the cell fermentation broth can be removed in one step, up to more than 98%. purity. With the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/31C07K19/00C12N15/31C12N15/62G01N33/68B01D15/38
CPCC07K14/31G01N33/6854B01D15/3809C07K2319/30Y02A50/30
Inventor王智
Owner百林科(兰州)新材料有限公司