Check patentability & draft patents in minutes with Patsnap Eureka AI!

Preparation and application of anti-FSHR (follicle stimulating hormone receptor) antibody and antibody-drug conjugate thereof

A technology of drug conjugates and antibodies, applied in botany equipment and methods, biochemical equipment and methods, anti-animal/human immunoglobulin, etc., to achieve significant killing effect and broad application prospects

Pending Publication Date: 2022-06-10
CANWELL BIOTECH LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there are no approved antibody drugs against FSHR on the market for cancer treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of anti-FSHR (follicle stimulating hormone receptor) antibody and antibody-drug conjugate thereof
  • Preparation and application of anti-FSHR (follicle stimulating hormone receptor) antibody and antibody-drug conjugate thereof
  • Preparation and application of anti-FSHR (follicle stimulating hormone receptor) antibody and antibody-drug conjugate thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0133] Example 1: Mouse anti-human FSHR monoclonal antibody CAN001

[0134] 1. Synthesize codon-optimized DNA fragments (as shown in SEQ ID NO:1 and SEQ ID NO:2) encoding the light chain and heavy chain of the anti-human FSHR monoclonal antibody by Genescript, and sequence and verify the synthesized DNA fragments the nucleotide sequence.

[0135] SEQ ID NO: 1: Light Chain DNA Sequence

[0136] ATGGCCCTCCCTGTCACCGCCCTGCTGCTTCCGCTGGCTCTTCTGCTCCACGCCGCTCGGCCCCAGATAGTACTTACGCAATCACCCGTCATAATGAGCGCATCCCCTGGTGAAAAGGTTACTCTGACATGCTCTGCGTCTTCCAGCGTGAGTAGTTCTTATCTCTATTGGTATCAGCAAAAACCCGGATCTTCTAGTAAATTGTGGATATATTCTACGTCTAATCTTGCGTCAGGAGTGCCTGCTCGGTTTTCTGGGTCCGGGTCCGGGACCAGCTATAGTTTGACTATAAGTAGTATGGAGGCGGAGGACGCAGCTAGCTACTTTTGCCATCAATGGAGCTCCTATCCTCCTACCTTTGGGGGCGGAACCAAATTGGAAATCAAAAGAGCCGACGCGGCACCCACTGTATCTATCTTCCCACCCTCATCAGAACAGCTCACTTCAGGCGGCGCCAGTGTGGTGTGTTTCCTCAACAACTTCTATCCTAAAGACATAAATGTAAAATGGAAAATAGACGGTAGCGAGCGGCAAAACGGGGTGCTGAACTCATGGACGGACCAAGATTCCAAGGATTCTACCTATTCAATGAGT...

Embodiment 2

[0149] Embodiment 2: Cloning of human FSHR gene and construction of expression vector

[0150]The RNA extracted from the OVCAR3 cell line (purchased from ATCC, the catalog number is htb-161) was reverse-transcribed into cDNA, and the cDNA was used as a template to perform PCR amplification with FSHR-F and FSHR-R as primers to obtain a fragment containing the FSHR gene .

[0151] FSHR-F: 5'-gtttCCACAACCatggccctgctcctgg-3' (SEQ ID NO: 13);

[0152] FSHR-R: 5'-ggttgattaactcgagttagttttgggctaaatgacttagagggacaag-3' (SEQ ID NO: 14).

[0153] The fragment containing the FSHR gene was cloned into the cloning vector pJET2.1 (purchased from Thermo Fisher, catalog number SO501), and the pJET2.1-FSHR plasmid was constructed. After sequencing verification, the insert fragment was subcloned into the NcoI and XhoI sites of pMSGβ3, and the pMSGβ3_FSHR plasmid was constructed. The pMSGβ3_FSHR plasmid map is as follows: figure 1 shown.

Embodiment 3

[0154] Example 3: Production of antibody CAN001 in HEK293T cells

[0155] In order to prepare CAN001 antibody, HEK293T cells were cultured in serum-free medium, and vectors pcDNA3.1_CAN001 HC and pcDNA3.1_CAN001 LC (mass ratio 1:2) encoding CAN001 heavy chain and light chain were mixed with 25kD linear PEI polymer (polyscience ) according to the carrier: polymer mass ratio of 1:3 complex transfection of HEK293T cells. After transfection, the HEK293T cells were cultured for 72 hours, and the culture supernatant was collected, which was the supernatant containing the CAN001 antibody.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses preparation and application of an anti-FSHR (follicle stimulating hormone receptor) antibody and an antibody-drug conjugate thereof. The invention discloses an antibody or an antigen-binding fragment thereof, the antibody or the antigen-binding fragment thereof comprises a variable region which specifically binds to a human follicle stimulating hormone receptor (FSHR) and comprises one, two, three, four, five or six CDRs selected from amino acid sequences shown as SEQ ID NO: 6, 7, 8, 10, 11 and 12, and the antibody or the antigen-binding fragment thereof comprises one, two, three, four, five or six CDRs selected from amino acid sequences shown as SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12. The anti-FSHR antibody and the antibody-drug conjugate thereof provided by the invention have wide application prospects in detection, screening, prevention and treatment of cancers.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the preparation and application of an anti-FSHR antibody and an antibody-drug conjugate thereof. Background technique [0002] The human follicle stimulating hormone receptor (FSHR) is an 80 kD G protein coupled membrane receptor. The FSHR extracellular domain consists of a 9-leucine-rich repeat (LRR) domain, an extracellular hinge loop, a 7-helix transmembrane domain and a cytoplasmic domain. The LRR domain is responsible for high-affinity binding of FSH, the hinge loop is responsible for receptor activation, and the transmembrane and cytoplasmic domains are responsible for receptor signaling [1-4] . [0003] Human FSHR is mainly expressed in ovarian granulosa cells and testicular Sertoli cells [5] . The natural protein ligand of FSHR, recombinant follicle-stimulating hormone (FSH), has been clinically used to treat male and female infertility. Several small molecule allosteric m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13C12N15/85A61K47/68A61K38/07A61P35/00G01N33/76G01N33/574
CPCC07K16/2869C12N15/85A61K47/6803A61K47/6817A61K47/6849A61K38/07A61P35/00G01N33/76G01N33/57484C07K2317/565C07K2317/56C12N2800/107C12N2800/22G01N2333/726G01N33/574A61K47/68031A61K47/6851C07K2317/73A61K38/08A61K2039/505C07K2317/92
Inventor 余宁辉江旭亮
Owner CANWELL BIOTECH LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More