Preparation and application of anti-FSHR (follicle stimulating hormone receptor) antibody and antibody-drug conjugate thereof
A technology of drug conjugates and antibodies, applied in botany equipment and methods, biochemical equipment and methods, anti-animal/human immunoglobulin, etc., to achieve significant killing effect and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0133] Example 1: Mouse anti-human FSHR monoclonal antibody CAN001
[0134] 1. Synthesize codon-optimized DNA fragments (as shown in SEQ ID NO:1 and SEQ ID NO:2) encoding the light chain and heavy chain of the anti-human FSHR monoclonal antibody by Genescript, and sequence and verify the synthesized DNA fragments the nucleotide sequence.
[0135] SEQ ID NO: 1: Light Chain DNA Sequence
[0136] ATGGCCCTCCCTGTCACCGCCCTGCTGCTTCCGCTGGCTCTTCTGCTCCACGCCGCTCGGCCCCAGATAGTACTTACGCAATCACCCGTCATAATGAGCGCATCCCCTGGTGAAAAGGTTACTCTGACATGCTCTGCGTCTTCCAGCGTGAGTAGTTCTTATCTCTATTGGTATCAGCAAAAACCCGGATCTTCTAGTAAATTGTGGATATATTCTACGTCTAATCTTGCGTCAGGAGTGCCTGCTCGGTTTTCTGGGTCCGGGTCCGGGACCAGCTATAGTTTGACTATAAGTAGTATGGAGGCGGAGGACGCAGCTAGCTACTTTTGCCATCAATGGAGCTCCTATCCTCCTACCTTTGGGGGCGGAACCAAATTGGAAATCAAAAGAGCCGACGCGGCACCCACTGTATCTATCTTCCCACCCTCATCAGAACAGCTCACTTCAGGCGGCGCCAGTGTGGTGTGTTTCCTCAACAACTTCTATCCTAAAGACATAAATGTAAAATGGAAAATAGACGGTAGCGAGCGGCAAAACGGGGTGCTGAACTCATGGACGGACCAAGATTCCAAGGATTCTACCTATTCAATGAGT...
Embodiment 2
[0149] Embodiment 2: Cloning of human FSHR gene and construction of expression vector
[0150]The RNA extracted from the OVCAR3 cell line (purchased from ATCC, the catalog number is htb-161) was reverse-transcribed into cDNA, and the cDNA was used as a template to perform PCR amplification with FSHR-F and FSHR-R as primers to obtain a fragment containing the FSHR gene .
[0151] FSHR-F: 5'-gtttCCACAACCatggccctgctcctgg-3' (SEQ ID NO: 13);
[0152] FSHR-R: 5'-ggttgattaactcgagttagttttgggctaaatgacttagagggacaag-3' (SEQ ID NO: 14).
[0153] The fragment containing the FSHR gene was cloned into the cloning vector pJET2.1 (purchased from Thermo Fisher, catalog number SO501), and the pJET2.1-FSHR plasmid was constructed. After sequencing verification, the insert fragment was subcloned into the NcoI and XhoI sites of pMSGβ3, and the pMSGβ3_FSHR plasmid was constructed. The pMSGβ3_FSHR plasmid map is as follows: figure 1 shown.
Embodiment 3
[0154] Example 3: Production of antibody CAN001 in HEK293T cells
[0155] In order to prepare CAN001 antibody, HEK293T cells were cultured in serum-free medium, and vectors pcDNA3.1_CAN001 HC and pcDNA3.1_CAN001 LC (mass ratio 1:2) encoding CAN001 heavy chain and light chain were mixed with 25kD linear PEI polymer (polyscience ) according to the carrier: polymer mass ratio of 1:3 complex transfection of HEK293T cells. After transfection, the HEK293T cells were cultured for 72 hours, and the culture supernatant was collected, which was the supernatant containing the CAN001 antibody.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap