Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and kit for detecting CGG repetition number of FMR1 gene

A kit and repeat number technology, applied in the field of biological diagnosis, can solve the problems of high experimental requirements, complex system and high cost, and achieve the effects of improving detection efficiency and quick and easy method.

Pending Publication Date: 2022-06-21
THE CHILDRENS HOSPITAL ZHEJIANG UNIV SCHOOL OF MEDICINE +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to reasons such as high cost, high experimental requirements, complex system, and long cycle, the wide-scale application is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and kit for detecting CGG repetition number of FMR1 gene
  • Primer and kit for detecting CGG repetition number of FMR1 gene
  • Primer and kit for detecting CGG repetition number of FMR1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Design and detection of primers for detection of CGG repeat number of FMR1 gene

[0035] (1) Design primers F and R for amplifying and detecting target fragments at the two ends of the FMR1 gene CGG repeat sequence; the sequence of the upstream primer F for detecting the CGG repeat number is as shown in SEQ ID NO: 1, and its 5' FAM fluorescence at the end; the sequence of the downstream primer R is shown in SEQ ID NO: 2; the specific table below:

[0036] serial number Primer (5'-3') SEQ ID NO:1 FAM-AGCCCCGCACTTCCCACCACCAGCTCCTCCA SEQ ID NO:2 GCTCAGCTCCGTTTCGGTTTCACTTCCGGT

[0037] (2) Reaction system:

[0038] Mix1:

[0039] Reagent System (μL) Water 1.8 1mM dATP 0.75 1mM dCTP 0.75 1mM dTTP 0.75 5mM 7-deaza-ATP 0.05 10uM SEQ1(FMR1-F) 0.2 10uM SEQ2(FMR1-R) 0.2 GC-Rich resolution solution 3.5 (individually added)

[0040] Mix2:

[0041] Reagent System ...

Embodiment 2

[0050]Example 2 Detection of CGG Repeat Numbers in Normal Male Samples

[0051] (1) DNA extraction: Peripheral blood was collected with the consent of the subject or the knowledge of his guardian. A commercially available genomic DNA extraction kit was used to extract genomic DNA from peripheral blood samples.

[0052] (2) Use the primers of Example 1 and kits thereof to prepare a PCR reaction system, carry out PCR amplification to the sample FMR1 gene CGG repeat sequence, and the PCR reaction system includes the first PCR reaction solution (Mix1) and the second PCR reaction solution ( Mix2), the components of the first PCR reaction solution (Mix1) are: water: 1.8 μL; 1mM dATP: 0.75 μL; 1mM dTTP: 0.75 μL; 1mMdCTP: 0.75 μL; 5mM 7-deaza-ATP: 0.05 μL; 10μM F: 0.2μL; 10μM R: 0.2μL; GC-Richresolution solution: 3.5μL;

[0053] The components of the second PCR reaction solution (Mix2) are: water: 0.8 μL; 5×GC-Rich Reaction Buffer: 2 μL; GC-Rich Enzyme Mix: 2 μL;

[0054] After the...

Embodiment 3

[0058] Example 3 Detection of CGG Repeat Numbers in Normal Female Samples

[0059] (1) DNA extraction: Peripheral blood was collected with the consent of the subject or the knowledge of his guardian. A commercially available genomic DNA extraction kit was used to extract genomic DNA from peripheral blood samples.

[0060] (2) Use the primers of Example 1 and kits thereof to prepare a PCR reaction system, carry out PCR amplification to the sample FMR1 gene CGG repeat sequence, and the PCR reaction system includes the first PCR reaction solution (Mix1) and the second PCR reaction solution ( Mix2), the components of the first PCR reaction solution (Mix1) are: water: 1.8 μL; 1mM dATP: 0.75 μL; 1mM dTTP: 0.75 μL; 1mMdCTP: 0.75 μL; 5mM 7-deaza-ATP: 0.05 μL; 10μM F: 0.2μL; 10μM R: 0.2μL; GC-Richresolution solution: 3.5μL;

[0061] The components of the second PCR reaction solution (Mix2) are: water: 0.8 μL; 5×GC-Rich Reaction Buffer: 2 μL; GC-Rich Enzyme Mix: 2 μL;

[0062] After ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for detecting a CGG repetitive sequence of an FMR1 gene and a kit thereof. The kit comprises an upstream primer F, a downstream primer R, DNA polymerase, a buffer solution, a reinforcing agent, dNTPs and a standard contrast, wherein the upstream primer F and the downstream primer R are used for detecting the CGG repetition number of the FMR1 gene. Through a high-GC-content PCR system, a PCR product is analyzed through capillary electrophoresis, and the kit can be used for accurately and quantitatively analyzing the CGG repetition number of the FMR1 gene within 200. The kit is simple and convenient to operate, convenient and rapid, low in cost, high in accuracy and capable of achieving rapid standardized detection.

Description

technical field [0001] The invention belongs to the field of biological diagnosis, and in particular relates to a primer for detecting CGG repeat number of FMR1 gene and a kit thereof. Background technique [0002] Fragile X Syndrome (FXS) is an X chromosome incompletely linked dominant genetic disease, and is the most common single gene disease causing congenital mental retardation and autism disorder. According to statistics, the incidence rate is about 1 / 4000 in men and 1 / 6000 in women, second only to Down syndrome. The clinical phenotype is mainly moderate to severe mental retardation, and other manifestations are special facial features, such as protruding ears, wide forehead, large testicles in men, and premature ovarian failure in women. [0003] The vast majority of patients with fragile X syndrome are caused by the abnormal expansion of the 5' non-coding region (CGG) n-repeat sequence of the FMR1 gene, which leads to the inactivation of FMRP. The main biological f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/113C12Q2525/151C12Q2565/125C12Q2545/113
Inventor 舒强李学坤蒋梦怡王文君朱琳张民
Owner THE CHILDRENS HOSPITAL ZHEJIANG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com