Molecular marker of F3 'H homologous gene and application thereof

A genome and primer combination technology, applied in the field of biological breeding, can solve problems such as the unfavorable commercial value of broccoli curds, and achieve the effects of reducing the scale of planting and identification, high throughput, and accurate data collection

Pending Publication Date: 2022-07-01
SHANGHAI ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the actual production process of broccoli, changes in environmental factors (including temperature, light, etc.) often lead to the deposition of a large amount of purple anthocyanins on the spherical surface of the broccoli curd, which is extremely unfavorable to the realization of the commercial value of the broccoli curd

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of F3 'H homologous gene and application thereof
  • Molecular marker of F3 'H homologous gene and application thereof
  • Molecular marker of F3 'H homologous gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The purple curd broccoli material obtained in the field is the inbred line BT 126 as the female parent, the green curd broccoli material inbred line SN60 is the male parent (both BT126 and SN60 are from Shanghai Fengxian Zhuanghang Farm), and the female parent BT 126 is High anthocyanin content, the color of the curd is purple, and the male parent SN 60 has low anthocyanin content, and the color of the curd is green.

[0033] Through hybridization and selfing, 302 individual plants of the F2 isolated population were obtained, and the phenotype verification of the F2 population was carried out. The specific steps are as follows:

[0034] The F2 population plants were planted in a greenhouse, and the phenotypes of each individual plant were identified at least three times when the curds were mature. The curd color shows the color distribution from green to purple, divided into 5 grades, from 1 to 5: 1-green, 2-purple, 3-light purple, 4-slightly darker purple, and 5-purple...

Embodiment 2

[0040] A pair of primers, IndBoF3'H-F and IndBoF3'H-R, were designed for the deletion of F3'H-SN 60 and the structural features of F3'H-BT 126 and F3'H-SN 60. 126 was amplified to yield a 187 bp fragment, and SN 60 was amplified to yield a 144 bp fragment.

[0041] SEQ NO.1: (IndBoF3'H-F) CACGGACATGCTTAGCACTTTAAT

[0042] SEQ NO.2: (IndBoF3'H-R) GCCGTAAACATGTTCTGTAATGGA

[0043] The primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

Embodiment 3

[0045] 1. Using CTAB method, genomic DNA was extracted from broccoli leaves.

[0046] (1) Take an appropriate amount of fresh or frozen leaves of broccoli seedlings, put them into a 2ml centrifuge tube, add two steel balls, and grind them on a tissue grinder;

[0047] (2) Add 750 μL CTAB solution, shake to homogenize, and shake at 65°C for 0.5-1 h;

[0048] (3) Cool to room temperature, add 700 μL of chloroform:isoamyl alcohol (24:1, volume ratio) in a fume hood, and mix by hand and gently upside down for 15~20min;

[0049] (4) Centrifuge at 12000rpm for 12min, and take 400μL of supernatant into a new 1.5mL centrifuge tube;

[0050] (5) Add 2 volumes (800 μL) of ice ethanol to the supernatant, cover the centrifuge tube, shake it a few times, mix the ice ethanol and the supernatant well, and put it in a -20°C refrigerator Let stand for 20~30min;

[0051] (6) Centrifuge the standing centrifuge tube at 12,000 rpm for 5 minutes, then pour off the supernatant, add 500 μL of 75% ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination for identifying an F3 'H homologous gene. The primer combination is composed of two primers SEQNO.1 and SEQNO.2; the invention further discloses application of the primer combination in broccoli breeding. The invention relates to a molecular marker of a flavonoid 3 '-hydroxylase F3' H gene of broccoli, and a molecular marker of the flavonoid 3 '-hydroxylase F3' H gene of broccoli. The molecular marker of the F3 'H gene and a primer combination for detecting the molecular marker can be used for assisted breeding of broccoli, acceleration of the genetic improvement process of broccoli breeding and improvement of breeding selection efficiency, and have important theoretical and practical guiding significance.

Description

technical field [0001] The invention relates to the field of biological breeding, in particular to a molecular marker of an F3'H homologous gene and its application. Background technique [0002] Broccoli (Brassica oleracea var.italica) is one of the most important vegetable varieties in the world because its curds are rich in dietary fiber and a variety of vitamins and minerals, including potassium, folic acid, and vitamins A, C, and K, while deep Favored by Chinese and Western consumers. According to the data of the Ministry of Agriculture, the planting area of ​​broccoli in China currently exceeds 1.4 million mu, and its output ranks first in the world. As a representative of high-quality healthy vegetables, the curd composed of fleshy stems and inflorescence meristems is rich in vitamin C and glucosinolates anti-cancer substances, which meets the current needs of Chinese people for healthy vegetables. [0003] At present, breeders have successfully cultivated purple br...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2600/172C12Q2531/113
Inventor刘春晴姚雪琴李光庆黄雷谢祝捷
OwnerSHANGHAI ACAD OF AGRI SCI