Human vestibular nerve tunica vaginalis immortalized cell line and construction method thereof
A technology of immortalized cell line and construction method, applied in the field of human vestibular schwannoma immortalized cell line and its construction, which can solve problems such as tumor differences
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] 1. Isolation and culture of human vestibular schwannoma cells
[0033] 1. Experimental reagents:
[0034] (1) Complete medium: DMEM high glucose+1×N2 additive+Insulin 5μg / mL+10%FBS+1×Penicillin / Streptomycin solution (P / S);
[0035] (2) Basal medium: DMEM high glucose;
[0036] (3) Buffer: sterile without Ca 2+ and Mg 2+ 1×PBS+1×P / S, pH=7.4;
[0037] (4) Digestive solution: 0.125% trypsin + 0.1% type II collagenase;
[0038] (5) Coating solution: dissolve in sterile Laminin 10 μg / mL 1×PBS;
[0039] (6) 75% medical alcohol;
[0040] (7) Fetal bovine serum (FBS).
[0041] 2. Isolation and culture
[0042] (1) The vestibular schwannoma tissue taken out during the operation is placed in sterile PBS buffer and transported at low temperature;
[0043] (2) Take out the tissue in the ultra-clean workbench, soak it in 75% alcohol for about 2 minutes, and place it in PBS containing P / S;
[0044] (3) Cut the tissue block into a square with a side length of about 0.1 cm, d...
Embodiment 2
[0049] 2. Immunofluorescence identification
[0050] (1) Cell climbing sheet
[0051] Take 3 pieces of glass slides into a 24-well plate, add 1 mL of medium to each well, add 0.02 million cells / well, and place in an incubator for 2 h or overnight.
[0052] (2) Fixed
[0053] After the cells climbed, the medium was aspirated, washed once with PBS, and fixed at 4°C for 30 min by adding 4% PFA. Wash with PBS 3×5min / time. You can also leave the PBS at 4°C overnight without aspirating it for the last time.
[0054] (3) Membrane rupture closure
[0055] Glass block blocking solution configuration: 0.5% Trition X-100 mixed with PBS 1:1, plus 10% fetal bovine serum.
[0056] Remove the water from the glass slide, place it on the support of the petri dish, take 50 μL of membrane-breaking sealing droplets on the waterproof membrane, and cover the side with cells on the glass slide for 2 h.
[0057] (4) Primary antibody incubation
[0058] Primary antibody preparation: S100 antibo...
Embodiment 3
[0067] 3. Transfection
[0068] (1) Basic information of SV40 overexpression lentivirus
[0069] SV40 overexpressing lentivirus
[0070] 1), the original information of the carrier: EF1α-SV40-IRES-puromycin;
[0071] 2), the carrier carries the fluorescent label: none;
[0072] 3), vector resistance gene marker: puromycin (puromycin);
[0073] 4), the vector map such as image 3 As shown, the characteristics of immortalized virus are clarified;
[0074] 5), the target sequence information of the vector is as follows:
[0075] The underlined area is the target sequence area
[0076] GTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGGATCTATTTCCGGTGAATTC ATGGATAA AGTTTTAAACAGAGAGGAATCTTTGCAGCTAATGGACCTTCTAGGTCTTGAAAGGAGTGCCTGGGGGAATATTCCT CTGATGAGAAAGGCATATTTAAAAAAATGCAAGGAGTTTCATCCTGATAAAAGGAGGAGGATGAAGAAAAAATGAAGA AAATGAATACTCTGTACAAGAAAATGGAAGATGGAGTAAAATATGCTCATCAACCTGACTTTGGAGGCTTCTGGGA TGCAACTGAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTT TGCT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



