Supercharge Your Innovation With Domain-Expert AI Agents!

Human vestibular nerve tunica vaginalis immortalized cell line and construction method thereof

A technology of immortalized cell line and construction method, applied in the field of human vestibular schwannoma immortalized cell line and its construction, which can solve problems such as tumor differences

Pending Publication Date: 2022-07-29
SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Disadvantages: There are differences in the same tumor in different individuals, that is, JEI-002 can only represent the characteristics of the patient's vestibular schwannoma itself, which is the common characteristic of all cell lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human vestibular nerve tunica vaginalis immortalized cell line and construction method thereof
  • Human vestibular nerve tunica vaginalis immortalized cell line and construction method thereof
  • Human vestibular nerve tunica vaginalis immortalized cell line and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Isolation and culture of human vestibular schwannoma cells

[0033] 1. Experimental reagents:

[0034] (1) Complete medium: DMEM high glucose+1×N2 additive+Insulin 5μg / mL+10%FBS+1×Penicillin / Streptomycin solution (P / S);

[0035] (2) Basal medium: DMEM high glucose;

[0036] (3) Buffer: sterile without Ca 2+ and Mg 2+ 1×PBS+1×P / S, pH=7.4;

[0037] (4) Digestive solution: 0.125% trypsin + 0.1% type II collagenase;

[0038] (5) Coating solution: dissolve in sterile Laminin 10 μg / mL 1×PBS;

[0039] (6) 75% medical alcohol;

[0040] (7) Fetal bovine serum (FBS).

[0041] 2. Isolation and culture

[0042] (1) The vestibular schwannoma tissue taken out during the operation is placed in sterile PBS buffer and transported at low temperature;

[0043] (2) Take out the tissue in the ultra-clean workbench, soak it in 75% alcohol for about 2 minutes, and place it in PBS containing P / S;

[0044] (3) Cut the tissue block into a square with a side length of about 0.1 cm, d...

Embodiment 2

[0049] 2. Immunofluorescence identification

[0050] (1) Cell climbing sheet

[0051] Take 3 pieces of glass slides into a 24-well plate, add 1 mL of medium to each well, add 0.02 million cells / well, and place in an incubator for 2 h or overnight.

[0052] (2) Fixed

[0053] After the cells climbed, the medium was aspirated, washed once with PBS, and fixed at 4°C for 30 min by adding 4% PFA. Wash with PBS 3×5min / time. You can also leave the PBS at 4°C overnight without aspirating it for the last time.

[0054] (3) Membrane rupture closure

[0055] Glass block blocking solution configuration: 0.5% Trition X-100 mixed with PBS 1:1, plus 10% fetal bovine serum.

[0056] Remove the water from the glass slide, place it on the support of the petri dish, take 50 μL of membrane-breaking sealing droplets on the waterproof membrane, and cover the side with cells on the glass slide for 2 h.

[0057] (4) Primary antibody incubation

[0058] Primary antibody preparation: S100 antibo...

Embodiment 3

[0067] 3. Transfection

[0068] (1) Basic information of SV40 overexpression lentivirus

[0069] SV40 overexpressing lentivirus

[0070] 1), the original information of the carrier: EF1α-SV40-IRES-puromycin;

[0071] 2), the carrier carries the fluorescent label: none;

[0072] 3), vector resistance gene marker: puromycin (puromycin);

[0073] 4), the vector map such as image 3 As shown, the characteristics of immortalized virus are clarified;

[0074] 5), the target sequence information of the vector is as follows:

[0075] The underlined area is the target sequence area

[0076] GTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGGATCTATTTCCGGTGAATTC ATGGATAA AGTTTTAAACAGAGAGGAATCTTTGCAGCTAATGGACCTTCTAGGTCTTGAAAGGAGTGCCTGGGGGAATATTCCT CTGATGAGAAAGGCATATTTAAAAAAATGCAAGGAGTTTCATCCTGATAAAAGGAGGAGGATGAAGAAAAAATGAAGA AAATGAATACTCTGTACAAGAAAATGGAAGATGGAGTAAAATATGCTCATCAACCTGACTTTGGAGGCTTCTGGGA TGCAACTGAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTT TGCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a human-derived vestibular nerve tunica vaginalis immortalized cell line and a construction method thereof, the vestibular nerve tunica vaginalis immortalized cell line is JEI-002, primary cells of the tunica vaginalis are obtained by culturing sporadic vestibular nerve tunica vaginalis cells in vitro, SV40 genes in the cells are overexpressed by utilizing a lentivirus transfection technology, and the human-derived vestibular nerve tunica vaginalis immortalized cell line is obtained. In the transfection technical process, the target sequence of the vector is shown as SEQ ID NO.1, so that the vector has an immortalized characteristic, namely the characteristic that the proliferation capacity of benign tumors is limited is overcome, and a cell vector basis is provided for in-vivo and in-vitro experiments; the JEI-002 is a human-derived cell line taken from a sporadic vestibular neuroma patient, provides different vestibular neurotunica vaginalis cells, and provides a variety of material bases and research platforms for the mechanism research of vestibular neurotunica vaginalis in the future.

Description

technical field [0001] The invention belongs to the field of cell technology, and in particular relates to a human vestibular schwannoma immortalized cell line and a construction method thereof. Background technique [0002] JEI-002 is a stable human cell line established by culturing tumor cells from patients with sporadic Vestibular Schwannoma (sVS). [0003] Vestibular schwannoma is a benign tumor originating from vestibular schwannoma cells, which grows in the cerebellopontine angle. The gradual increase of the tumor will compress the surrounding cranial nerves and brain tissue, resulting in hearing loss, tinnitus, vertigo, facial paralysis, etc. Clinical symptoms, and even life-threatening patients. Its etiology is divided into two types, sporadic vestibular schwannoma and neurofibromatosis type 2 (neurofibromatosis type 2, NF2), the latter is a rare familial hereditary disease. According to the long-term clinical follow-up observation of large-scale cases abroad, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867C12N15/37C12R1/91
CPCC12N5/0693C12N5/0618C12N15/86C07K14/005C12N2740/15043C12N2510/04C12N2800/107C12N2710/22022
Inventor 吴皓汪照炎薛璐何维维舒文莹王耀萱
Owner SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More