Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant phosphorus hunger inducing transcription factor OsPTF1

A technology of phosphorus starvation and plant application in the field of genetic engineering, which can solve the problems of not being able to be absorbed and utilized by plants, and achieve the effects of improving phosphorus starvation resistance, reducing the application of phosphorus fertilizers, and reducing food production costs

Inactive Publication Date: 2003-08-20
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after the phosphate fertilizer is applied to the soil, it is quickly fixed by calcium salts in alkaline soils and iron and aluminum hydroxides in acidic soils or adsorbed by soil colloids, thus transforming into a fixed state that cannot be absorbed and utilized by plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant phosphorus hunger inducing transcription factor OsPTF1
  • Plant phosphorus hunger inducing transcription factor OsPTF1
  • Plant phosphorus hunger inducing transcription factor OsPTF1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The rice Kasalath variety was soaked at 37°C to accelerate germination, sowed in a yellow sand pot, and transplanted to hydroponic culture after 7 days (the hydroponic culture formula is the standard formula of the International Rice Institute). After the seedlings were cultivated to the three-leaf stage, they began to be divided into groups, one group was cultured normally, and the other group was cultured with phosphorus starvation. After cultivating for 4 days, the materials were collected, and the root materials were collected respectively, and the total RNA was extracted with Trizol from Gibco Company. Oligotex mRNA Mini Kit from Qiagen was used to extract mRNA from 250 g of total RNA, and 1 g of mRNA from each of the two materials was used for cDNA synthesis using SMARTTM PCR cDNA Synthesis Kit from Clontech. The cDNA of normal cultured root tissue was used as Driver, and the cDNA of starved material was used as Tester. The PCR-Select cDNA Subtraction Kit of Clon...

Embodiment 2

[0029] Using the cDNA materials for constructing the suppressive subtraction hybridization library, the PCR-Select Differential Screening kit was used to screen the suppressive subtraction hybridization library to obtain OsPTF1 gene fragment clones. The clone was sequenced and primers designed for rapid amplification of cDNA ends (RACE). Primer 1: ATTTCACAAGGGCCAACAGACAT, for 3' end RACE amplification, primer 2: CCCCCATATTTTTCCGATTTC, for 5' end RACE amplification. RACE amplification uses SMART RACE cDNA Amplification Kit from Clontech. The PCR product was cloned into the pT-Adv vector using the PCR Cloning Kit of Clontech Company. After transformation, the plasmid was extracted for sequencing. Finally, the sequence was spliced ​​using computer software to obtain a full-length cDNA sequence, a total of 1862bp. The detailed sequence is shown in SEQ ID No.1, wherein the open reading frame is located at nucleotides 67-1503. The amino acid sequence of OsPTF1 was deduced accordin...

Embodiment 3

[0030] The rice variety Kasalath that was normally cultured to the three-leaf stage began to be stressed by phosphorus starvation, and the treatment method was consistent with the process of constructing a suppressive subtraction hybrid library. After 4 days of stress, the roots and leaves of normal seedlings and the roots and leaves of starvation-treated seedlings were taken respectively. Total RNA was extracted with Trizol reagent from Gibco. 5 g of total RNA was taken from each of the 4 materials for reverse transcription. The reverse transcription process is as follows: add 5 μg RNA to a 1.5 μl centrifuge tube, 1 μl Oilgo(dT) 15 (Promega Company), add RNase-free water to 8 μl, denature in a 70°C water bath for 5 minutes, cool on ice for 5 minutes, add 4 μl 5×First Strand Buffer (Invitrogen Company), 2 μl 0.1DTT (Invitrogen Company), 4 μl 2.5mMdNTPs (Takara Company), 1 μl Rasin (40unit / l) (Promega Company) and 1 μl SuperScript RTII (Invitrogen Company), mixed with a gun, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one kind of plant phosphorus hunger inducing transcription factor OsPTF1. OsPTF1 is one new kind of gene separated from rice and comprises 1862 bases, and the nucleic acid encodes one rice root system phosphorus hunger inducing strengthening expressed bHLH transcription factor. Some data shows that the gene has constitutive expression in rice leaf and phosphorus hunger inducing expression in root. OsPTF1 joins the plant phosphorus utilizing process. Transgenic plant after expressing said gene has phosphorus hunger tolerance higher than that of wild plant. Therefore, utilizing the gene and technological process of the present invention can raise the phosphorus hunger tolerance of plant and cell.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a plant phosphorus starvation-induced transcription factor OsPTF1. The present invention relates to the cDNA sequence of rice OsPTF1, and the protein encoded by the cDNA belongs to bHLH family transcription factors. The present invention also relates to the polypeptide encoded by the nucleotide sequence, and the application of these polynucleotides and polypeptides. Background technique [0002] Phosphorus is an essential element in plant nutrition and plays an important role in its growth and development. Phosphorus is not only a component of many important organic compounds in plants, but also plays an important role in structure and physiology. At the same time, it participates in various physiological metabolic processes in plants in various ways. Early maturity, high yield, and high quality all play an important role. However, soil phosphoru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H1/00C07H21/04C12N15/29
Inventor 吴平易可可吴忠长吴运荣周洁杜黎明
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com