Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant phosphorus hunger inducing transcription factor OsPTF1

A technology of transcription factor and phosphorus starvation, which is applied in the field of genetic engineering, can solve the problems that cannot be absorbed and utilized by plants, and achieve the effect of improving phosphorus starvation resistance, reducing the application of phosphorus fertilizer, and reducing the cost of food production

Inactive Publication Date: 2005-05-04
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after the phosphate fertilizer is applied to the soil, it is quickly fixed by calcium salts in alkaline soils and iron and aluminum hydroxides in acidic soils or adsorbed by soil colloids, thus transforming into a fixed state that cannot be absorbed and utilized by plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant phosphorus hunger inducing transcription factor OsPTF1
  • Plant phosphorus hunger inducing transcription factor OsPTF1
  • Plant phosphorus hunger inducing transcription factor OsPTF1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1, Construction of Rice Suppressive Subtraction Hybridization Library

[0029] The rice Kasalath variety was soaked at 37°C to accelerate germination, sowed in a yellow sand pot, and transplanted to hydroponic culture after 7 days (the hydroponic culture formula is the standard formula of the International Rice Institute). After the seedlings were cultivated to the three-leaf stage, they began to be divided into groups, one group was cultured normally, and the other group was cultured with phosphorus starvation. After cultivating for 4 days, the materials were collected, and the root materials were collected respectively, and the total RNA was extracted with Trizol from Gibco Company. Oligotex mRNA Mini Kit from Qiagen was used to extract mRNA from 250 g of total RNA, and 1 g of mRNA from each of the two materials was used for cDNA synthesis using SMARTTM PCR cDNA Synthesis Kit from Clontech. The cDNA of normal cultured root tissue was used as Driver, and the c...

Embodiment 2

[0030] Example 2, Cloning and determination of the cDNA sequence of rice OsPTF1

[0031] Using the cDNA materials for constructing the suppressive subtraction hybridization library, the PCR-Select Differential Screening kit was used to screen the suppressive subtraction hybridization library to obtain OsPTF1 gene fragment clones. The clone was sequenced and primers designed for rapid amplification of cDNA ends (RACE). Primer 1: ATTTCACAAGGGCCAACAGACAT, for 3' end RACE amplification, primer 2: CCCCCATATTTTTCCGATTTC, for 5' end RACE amplification. RACE amplification uses SMART RACE cDNA Amplification Kit from Clontech. The PCR product was cloned into the pT-Adv vector using the PCR Cloning Kit of Clontech Company. After transformation, the plasmid was extracted for sequencing. Finally, the sequence was spliced ​​using computer software to obtain a full-length cDNA sequence, a total of 1862bp. The detailed sequence is shown in SEQ ID No.1, wherein the open reading frame is loca...

Embodiment 3

[0032] Example 3, semi-quantitative RT-PCR of OsPTF1

[0033] The rice variety Kasalath that was normally cultured to the three-leaf stage began to be stressed by phosphorus starvation, and the treatment method was consistent with the process of constructing a suppressive subtraction hybrid library. After 4 days of stress, the roots and leaves of normal seedlings and the roots and leaves of starvation-treated seedlings were taken respectively. Total RNA was extracted with Trizol reagent from Gibco. 5 g of total RNA was taken from each of the 4 materials for reverse transcription. The reverse transcription process is as follows: add 5 μg RNA to a 1.5 μl centrifuge tube, 1 μl Oilgo(dT) 15 (Promega Company), add RNase-free water to 8 μl, denature in a 70°C water bath for 5 minutes, cool on ice for 5 minutes, add 4 μl 5×First Strand Buffer (Invitrogen Company), 2 μl 0.1DTT (Invitrogen Company), 4 μl 2.5mMdNTPs (Takara Company), 1 μl Rasin (40unit / l) (Promega Company) and 1 μl S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant phosphorus starvation inducible transcription factor OsPTF1. It is a new gene OsPTF1 isolated from rice, consisting of 1862 bases, and the nucleic acid encodes a bHLH transcription factor that induces enhanced expression in rice root system phosphorus starvation. The data showed that the gene was constitutively expressed in rice leaves and induced by phosphorus starvation in roots. OsPTF1 is involved in the utilization of phosphorus in plants. The ability of transgenic plants overexpressing the gene to tolerate phosphorus starvation is higher than that of wild-type plants. Therefore, the ability of plants or their cells to withstand phosphorus starvation can be improved by using the genes and technical methods provided by the invention.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a plant phosphorus starvation-induced transcription factor OsPTF1. The present invention relates to the cDNA sequence of rice OsPTF1, and the protein encoded by the cDNA belongs to bHLH family transcription factors. The present invention also relates to the polypeptide encoded by the nucleotide sequence, and the application of these polynucleotides and polypeptides. Background technique [0002] Phosphorus is an essential element in plant nutrition and plays an important role in its growth and development. Phosphorus is not only a component of many important organic compounds in plants, but also plays an important role in structure and physiology. At the same time, it participates in various physiological metabolic processes in plants in various ways. Early maturity, high yield, and high quality all play an important role. However, soil phosphorus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01H1/00C07H21/04C12N15/29
Inventor 吴平易可可吴忠长吴运荣周洁杜黎明
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com